Incidental Mutation 'R5531:Stxbp5'
ID433705
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 9762924 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1044 (Q1044*)
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect probably null
Transcript: ENSMUST00000038213
AA Change: Q1080*
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: Q1080*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably null
Transcript: ENSMUST00000125200
AA Change: Q1027*
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: Q1027*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139199
Predicted Effect probably null
Transcript: ENSMUST00000141722
AA Change: Q1044*
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: Q1044*

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151435
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 I89L probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9808504 missense probably benign
R7974:Stxbp5 UTSW 10 9770695 splice site probably null
R8009:Stxbp5 UTSW 10 9816302 missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9784385 missense probably benign
R8353:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9812259 critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9812289 missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9817306 missense probably null 0.98
R8805:Stxbp5 UTSW 10 9838115 nonsense probably null
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9900545 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACCAAGTGCCTGCATACCTC -3'
(R):5'- AAATGTTTAGAGTGGTGCACTGTAG -3'

Sequencing Primer
(F):5'- AGTGCCTGCATACCTCATGAG -3'
(R):5'- TTTGCATATTTGGAAAAGCATGTAG -3'
Posted On2016-10-06