Mutagenetix > Incidental Mutation

Incidental Mutation 'R5531:Ncf4'

433716

Institutional Source

Beutler Lab

Gene Symbol

Ncf4

Ensembl Gene

ENSMUSG00000071715

Gene Name

neutrophil cytosolic factor 4

Synonyms

p40phox

MMRRC Submission

043089-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5531 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

78244801-78262580 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to G at 78260788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096357] [ENSMUST00000133618]

AlphaFold

P97369

Predicted Effect

probably benign
Transcript: ENSMUST00000096357

SMART Domains

Protein: ENSMUSP00000094084
Gene: ENSMUSG00000071715

Domain	Start	End	E-Value	Type
PX	18	136	3.16e-28	SMART
SH3	173	228	2.24e-19	SMART
PB1	237	329	8.06e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126028

Predicted Effect

probably benign
Transcript: ENSMUST00000133618

SMART Domains

Protein: ENSMUSP00000121191
Gene: ENSMUSG00000071715

Domain	Start	End	E-Value	Type
PX	18	136	3.16e-28	SMART
SH3	173	228	2.24e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146147

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148646

Coding Region Coverage

1x: 98.6%
3x: 97.5%
10x: 95.6%
20x: 92.2%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable but show impaired NADPH oxidase responses of neutrophils to a variety of stimuli and defective killing of S. aureus in vitro and in vivo. Homozygotes for a knock-in allele that prevents PtdIns3P binding to thePX domain fail in development prior to E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	G	19: 29,753,672	S647P	possibly damaging	Het
Acacb	T	C	5: 114,204,706	F878L	possibly damaging	Het
Acr	T	A	15: 89,573,943	Y276N	probably damaging	Het
AI987944	A	T	7: 41,374,390	Y388*	probably null	Het
Ankrd29	G	A	18: 12,279,778	T114I	probably damaging	Het
Ap5z1	T	C	5: 142,467,781	M168T	probably benign	Het
Bard1	A	C	1: 71,046,721	C608W	probably damaging	Het
Clspn	A	G	4: 126,577,773	R907G	probably benign	Het
Cubn	C	T	2: 13,350,932	V1830I	probably benign	Het
Cwc22	T	C	2: 77,924,569	N221S	probably damaging	Het
Dact3	A	G	7: 16,875,615	E64G	possibly damaging	Het
Dhx40	T	C	11: 86,789,504	E381G	possibly damaging	Het
Dnah7a	A	G	1: 53,419,748	S3744P	possibly damaging	Het
Epha4	A	G	1: 77,374,876	V914A	probably benign	Het
Fbxw10	G	A	11: 62,862,656	C492Y	probably damaging	Het
G930045G22Rik	C	A	6: 50,847,776		noncoding transcript	Het
Gm21103	A	T	14: 6,303,861	I63K	probably damaging	Het
Gpr156	T	C	16: 38,005,257	V612A	probably benign	Het
Gucy2g	A	G	19: 55,241,140	S33P	probably benign	Het
Hibch	A	G	1: 52,845,069		probably benign	Het
Hmcn1	A	T	1: 150,743,788	C1192S	probably damaging	Het
Hsd11b1	CGG	CG	1: 193,240,249		probably null	Het
Ifi214	A	G	1: 173,525,120	Y248H	probably damaging	Het
Igf2bp2	T	G	16: 22,089,085	I89L	probably damaging	Het
Il2ra	A	T	2: 11,676,892	T103S	possibly damaging	Het
Ino80	T	A	2: 119,445,575	M407L	probably benign	Het
Jade1	A	C	3: 41,613,511	K671N	probably benign	Het
Lca5	C	T	9: 83,398,595	S384N	probably benign	Het
Lce1l	G	T	3: 92,850,497	P18H	unknown	Het
Lrrc8d	T	C	5: 105,797,670		probably benign	Het
Ly75	T	C	2: 60,365,145	N223S	probably damaging	Het
Mcm3	A	T	1: 20,803,544	F784Y	possibly damaging	Het
Ncoa1	T	A	12: 4,253,746	M1362L	probably benign	Het
Olfr1	T	C	11: 73,395,177	T282A	probably benign	Het
Olfr467	A	G	7: 107,815,244	Y220C	probably benign	Het
Olfr765	G	C	10: 129,046,564	F166L	probably damaging	Het
Prkg2	T	C	5: 98,967,734	R543G	probably damaging	Het
Ptprd	A	C	4: 76,059,667		probably null	Het
Scap	A	G	9: 110,381,429	S969G	possibly damaging	Het
Sgk2	T	C	2: 162,994,704	F60S	probably benign	Het
Sgpp1	G	T	12: 75,735,207	Y119*	probably null	Het
Siglech	A	T	7: 55,768,665	K31*	probably null	Het
Slc40a1	A	G	1: 45,912,338	Y220H	probably damaging	Het
Smurf2	G	A	11: 106,852,563	T219M	possibly damaging	Het
Speer4f2	A	G	5: 17,376,528	K156R	possibly damaging	Het
Spp1	T	G	5: 104,440,558	D276E	probably benign	Het
Stk32b	T	C	5: 37,459,734		probably null	Het
Stxbp5	G	A	10: 9,762,924	Q1044*	probably null	Het
Sv2c	T	A	13: 95,961,378	T696S	probably damaging	Het
Tubgcp2	A	C	7: 140,005,024		probably null	Het
Ubap1l	C	T	9: 65,371,691	P91S	probably damaging	Het
Vmn2r76	A	T	7: 86,225,449	D773E	probably damaging	Het
Xirp2	C	G	2: 67,515,302	S2629C	probably benign	Het
Zbtb20	C	A	16: 43,610,867	C580*	probably null	Het
Zfp957	T	A	14: 79,213,182	Q392H	unknown	Het
Zfyve19	C	T	2: 119,211,946	T178M	probably damaging	Het
Zswim6	T	C	13: 107,769,593		noncoding transcript	Het

Other mutations in Ncf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01935:Ncf4	APN	15	78255986	missense	probably damaging	1.00
IGL02546:Ncf4	APN	15	78261019	missense	probably damaging	1.00
IGL03064:Ncf4	APN	15	78250902	missense	probably damaging	1.00
IGL03407:Ncf4	APN	15	78254781	splice site	probably benign
R0281:Ncf4	UTSW	15	78250883	missense	probably damaging	0.96
R0378:Ncf4	UTSW	15	78253303	missense	probably damaging	0.98
R1513:Ncf4	UTSW	15	78262360	missense	probably benign
R1596:Ncf4	UTSW	15	78250437	missense	probably damaging	1.00
R1652:Ncf4	UTSW	15	78261034	missense	possibly damaging	0.83
R1815:Ncf4	UTSW	15	78250402	missense	probably benign	0.00
R1847:Ncf4	UTSW	15	78250382	missense	probably benign	0.33
R1927:Ncf4	UTSW	15	78260646	missense	probably damaging	1.00
R2984:Ncf4	UTSW	15	78262320	missense	probably benign	0.09
R4302:Ncf4	UTSW	15	78260762	unclassified	probably benign
R4649:Ncf4	UTSW	15	78255989	missense	possibly damaging	0.61
R4905:Ncf4	UTSW	15	78254904	missense	probably damaging	0.99
R5114:Ncf4	UTSW	15	78262393	unclassified	probably benign
R5799:Ncf4	UTSW	15	78250977	missense	probably benign	0.00
R7284:Ncf4	UTSW	15	78260702	missense	probably benign	0.01
R8193:Ncf4	UTSW	15	78262266	missense	probably damaging	1.00
R9447:Ncf4	UTSW	15	78262299	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCTGAGACGTGACACTGG -3'
(R):5'- TCCACCGCAATGTCCCTAAG -3'

Sequencing Primer
(F):5'- TGGGTCTCACCAGCCTC -3'
(R):5'- CCTAAGGGGGACAGTAGAAGAGAC -3'

Posted On

2016-10-06