Incidental Mutation 'R5531:Igf2bp2'
ID433718
Institutional Source Beutler Lab
Gene Symbol Igf2bp2
Ensembl Gene ENSMUSG00000033581
Gene Nameinsulin-like growth factor 2 mRNA binding protein 2
SynonymsIMP-2, C330012H03Rik
MMRRC Submission 043089-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R5531 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22059009-22163299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22089085 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 89 (I89L)
Ref Sequence ENSEMBL: ENSMUSP00000097629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100052] [ENSMUST00000115379]
Predicted Effect probably damaging
Transcript: ENSMUST00000100052
AA Change: I89L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097629
Gene: ENSMUSG00000033581
AA Change: I89L

DomainStartEndE-ValueType
RRM 4 72 8.2e-11 SMART
RRM 83 153 4.07e-6 SMART
KH 185 256 1.28e-14 SMART
KH 266 339 1.97e-15 SMART
low complexity region 375 391 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
KH 419 490 1.1e-13 SMART
KH 501 573 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115379
AA Change: I21L

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111037
Gene: ENSMUSG00000033581
AA Change: I21L

DomainStartEndE-ValueType
RRM 15 85 4.07e-6 SMART
KH 117 188 1.28e-14 SMART
KH 198 271 1.97e-15 SMART
low complexity region 307 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
KH 351 422 1.1e-13 SMART
KH 433 505 2.48e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232504
Meta Mutation Damage Score 0.0933 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the 5' UTR of insulin-like growth factor 2 (IGF2) mRNA and regulates its translation. It plays an important role in metabolism and variation in this gene is associated with susceptibility to diabetes. Alternative splicing and promoter usage results in multiple transcript variants. Related pseudogenes are found on several chromosomes. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 S647P possibly damaging Het
Acacb T C 5: 114,204,706 F878L possibly damaging Het
Acr T A 15: 89,573,943 Y276N probably damaging Het
AI987944 A T 7: 41,374,390 Y388* probably null Het
Ankrd29 G A 18: 12,279,778 T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 M168T probably benign Het
Bard1 A C 1: 71,046,721 C608W probably damaging Het
Clspn A G 4: 126,577,773 R907G probably benign Het
Cubn C T 2: 13,350,932 V1830I probably benign Het
Cwc22 T C 2: 77,924,569 N221S probably damaging Het
Dact3 A G 7: 16,875,615 E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 V914A probably benign Het
Fbxw10 G A 11: 62,862,656 C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 noncoding transcript Het
Gm21103 A T 14: 6,303,861 I63K probably damaging Het
Gpr156 T C 16: 38,005,257 V612A probably benign Het
Gucy2g A G 19: 55,241,140 S33P probably benign Het
Hibch A G 1: 52,845,069 probably benign Het
Hmcn1 A T 1: 150,743,788 C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 probably null Het
Ifi214 A G 1: 173,525,120 Y248H probably damaging Het
Il2ra A T 2: 11,676,892 T103S possibly damaging Het
Ino80 T A 2: 119,445,575 M407L probably benign Het
Jade1 A C 3: 41,613,511 K671N probably benign Het
Lca5 C T 9: 83,398,595 S384N probably benign Het
Lce1l G T 3: 92,850,497 P18H unknown Het
Lrrc8d T C 5: 105,797,670 probably benign Het
Ly75 T C 2: 60,365,145 N223S probably damaging Het
Mcm3 A T 1: 20,803,544 F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 probably benign Het
Ncoa1 T A 12: 4,253,746 M1362L probably benign Het
Olfr1 T C 11: 73,395,177 T282A probably benign Het
Olfr467 A G 7: 107,815,244 Y220C probably benign Het
Olfr765 G C 10: 129,046,564 F166L probably damaging Het
Prkg2 T C 5: 98,967,734 R543G probably damaging Het
Ptprd A C 4: 76,059,667 probably null Het
Scap A G 9: 110,381,429 S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 F60S probably benign Het
Sgpp1 G T 12: 75,735,207 Y119* probably null Het
Siglech A T 7: 55,768,665 K31* probably null Het
Slc40a1 A G 1: 45,912,338 Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 K156R possibly damaging Het
Spp1 T G 5: 104,440,558 D276E probably benign Het
Stk32b T C 5: 37,459,734 probably null Het
Stxbp5 G A 10: 9,762,924 Q1044* probably null Het
Sv2c T A 13: 95,961,378 T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 probably null Het
Ubap1l C T 9: 65,371,691 P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 D773E probably damaging Het
Xirp2 C G 2: 67,515,302 S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 C580* probably null Het
Zfp957 T A 14: 79,213,182 Q392H unknown Het
Zfyve19 C T 2: 119,211,946 T178M probably damaging Het
Zswim6 T C 13: 107,769,593 noncoding transcript Het
Other mutations in Igf2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Igf2bp2 APN 16 22063704 missense probably damaging 1.00
IGL02374:Igf2bp2 APN 16 22081868 missense probably benign 0.00
IGL02752:Igf2bp2 APN 16 22080110 missense probably benign 0.00
IGL02884:Igf2bp2 APN 16 22162885 missense probably benign 0.00
IGL03072:Igf2bp2 APN 16 22068141 critical splice donor site probably null
defender UTSW 16 22070306 critical splice donor site probably null
Petite UTSW 16 22079608 critical splice acceptor site probably null
R0008:Igf2bp2 UTSW 16 22076091 missense probably benign 0.22
R0183:Igf2bp2 UTSW 16 22078730 nonsense probably null
R0390:Igf2bp2 UTSW 16 22081801 missense possibly damaging 0.87
R0505:Igf2bp2 UTSW 16 22089099 missense possibly damaging 0.90
R0610:Igf2bp2 UTSW 16 22070309 missense probably benign 0.00
R0696:Igf2bp2 UTSW 16 22080125 missense probably benign 0.19
R0966:Igf2bp2 UTSW 16 22089090 missense probably damaging 1.00
R1101:Igf2bp2 UTSW 16 22162950 missense probably damaging 1.00
R1159:Igf2bp2 UTSW 16 22061853 splice site probably benign
R1169:Igf2bp2 UTSW 16 22078730 nonsense probably null
R1762:Igf2bp2 UTSW 16 22083947 nonsense probably null
R2168:Igf2bp2 UTSW 16 22079608 critical splice acceptor site probably null
R4014:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4015:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4016:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4017:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4128:Igf2bp2 UTSW 16 22078621 missense probably benign 0.00
R4986:Igf2bp2 UTSW 16 22070306 critical splice donor site probably null
R5007:Igf2bp2 UTSW 16 22079496 missense probably damaging 1.00
R5268:Igf2bp2 UTSW 16 22079491 missense probably damaging 1.00
R6154:Igf2bp2 UTSW 16 22076093 nonsense probably null
R6819:Igf2bp2 UTSW 16 22060836 missense probably damaging 1.00
R6975:Igf2bp2 UTSW 16 22061861 missense probably null 1.00
R7008:Igf2bp2 UTSW 16 22081832 missense probably benign 0.16
R7311:Igf2bp2 UTSW 16 22061882 missense possibly damaging 0.76
R8011:Igf2bp2 UTSW 16 22076099 missense not run
R8045:Igf2bp2 UTSW 16 22083978 missense not run
X0066:Igf2bp2 UTSW 16 22161291 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATCAAACCACATGGCTGGTG -3'
(R):5'- TGCTGTTTAGAATAGGAATGTCTGC -3'

Sequencing Primer
(F):5'- TGCTGGTACTCAGTGGCC -3'
(R):5'- AATAGGAATGTCTGCATATGCTTTGG -3'
Posted On2016-10-06