Incidental Mutation 'R5531:Gucy2g'
ID 433724
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Name guanylate cyclase 2g
Synonyms GC-G, 2410077I05Rik
MMRRC Submission 043089-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5531 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 55198297-55241236 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55241140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 33 (S33P)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
AlphaFold Q6TL19
Predicted Effect probably benign
Transcript: ENSMUST00000069183
AA Change: S33P

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: S33P

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.5%
  • 10x: 95.6%
  • 20x: 92.2%
Validation Efficiency 97% (64/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,753,672 (GRCm38) S647P possibly damaging Het
Acacb T C 5: 114,204,706 (GRCm38) F878L possibly damaging Het
Acr T A 15: 89,573,943 (GRCm38) Y276N probably damaging Het
AI987944 A T 7: 41,374,390 (GRCm38) Y388* probably null Het
Ankrd29 G A 18: 12,279,778 (GRCm38) T114I probably damaging Het
Ap5z1 T C 5: 142,467,781 (GRCm38) M168T probably benign Het
Bard1 A C 1: 71,046,721 (GRCm38) C608W probably damaging Het
Clspn A G 4: 126,577,773 (GRCm38) R907G probably benign Het
Cubn C T 2: 13,350,932 (GRCm38) V1830I probably benign Het
Cwc22 T C 2: 77,924,569 (GRCm38) N221S probably damaging Het
Dact3 A G 7: 16,875,615 (GRCm38) E64G possibly damaging Het
Dhx40 T C 11: 86,789,504 (GRCm38) E381G possibly damaging Het
Dnah7a A G 1: 53,419,748 (GRCm38) S3744P possibly damaging Het
Epha4 A G 1: 77,374,876 (GRCm38) V914A probably benign Het
Fbxw10 G A 11: 62,862,656 (GRCm38) C492Y probably damaging Het
G930045G22Rik C A 6: 50,847,776 (GRCm38) noncoding transcript Het
Gm21103 A T 14: 6,303,861 (GRCm38) I63K probably damaging Het
Gpr156 T C 16: 38,005,257 (GRCm38) V612A probably benign Het
Hibch A G 1: 52,845,069 (GRCm38) probably benign Het
Hmcn1 A T 1: 150,743,788 (GRCm38) C1192S probably damaging Het
Hsd11b1 CGG CG 1: 193,240,249 (GRCm38) probably null Het
Ifi214 A G 1: 173,525,120 (GRCm38) Y248H probably damaging Het
Igf2bp2 T G 16: 22,089,085 (GRCm38) I89L probably damaging Het
Il2ra A T 2: 11,676,892 (GRCm38) T103S possibly damaging Het
Ino80 T A 2: 119,445,575 (GRCm38) M407L probably benign Het
Jade1 A C 3: 41,613,511 (GRCm38) K671N probably benign Het
Lca5 C T 9: 83,398,595 (GRCm38) S384N probably benign Het
Lce1l G T 3: 92,850,497 (GRCm38) P18H unknown Het
Lrrc8d T C 5: 105,797,670 (GRCm38) probably benign Het
Ly75 T C 2: 60,365,145 (GRCm38) N223S probably damaging Het
Mcm3 A T 1: 20,803,544 (GRCm38) F784Y possibly damaging Het
Ncf4 T G 15: 78,260,788 (GRCm38) probably benign Het
Ncoa1 T A 12: 4,253,746 (GRCm38) M1362L probably benign Het
Olfr1 T C 11: 73,395,177 (GRCm38) T282A probably benign Het
Olfr467 A G 7: 107,815,244 (GRCm38) Y220C probably benign Het
Olfr765 G C 10: 129,046,564 (GRCm38) F166L probably damaging Het
Prkg2 T C 5: 98,967,734 (GRCm38) R543G probably damaging Het
Ptprd A C 4: 76,059,667 (GRCm38) probably null Het
Scap A G 9: 110,381,429 (GRCm38) S969G possibly damaging Het
Sgk2 T C 2: 162,994,704 (GRCm38) F60S probably benign Het
Sgpp1 G T 12: 75,735,207 (GRCm38) Y119* probably null Het
Siglech A T 7: 55,768,665 (GRCm38) K31* probably null Het
Slc40a1 A G 1: 45,912,338 (GRCm38) Y220H probably damaging Het
Smurf2 G A 11: 106,852,563 (GRCm38) T219M possibly damaging Het
Speer4f2 A G 5: 17,376,528 (GRCm38) K156R possibly damaging Het
Spp1 T G 5: 104,440,558 (GRCm38) D276E probably benign Het
Stk32b T C 5: 37,459,734 (GRCm38) probably null Het
Stxbp5 G A 10: 9,762,924 (GRCm38) Q1044* probably null Het
Sv2c T A 13: 95,961,378 (GRCm38) T696S probably damaging Het
Tubgcp2 A C 7: 140,005,024 (GRCm38) probably null Het
Ubap1l C T 9: 65,371,691 (GRCm38) P91S probably damaging Het
Vmn2r76 A T 7: 86,225,449 (GRCm38) D773E probably damaging Het
Xirp2 C G 2: 67,515,302 (GRCm38) S2629C probably benign Het
Zbtb20 C A 16: 43,610,867 (GRCm38) C580* probably null Het
Zfp957 T A 14: 79,213,182 (GRCm38) Q392H unknown Het
Zfyve19 C T 2: 119,211,946 (GRCm38) T178M probably damaging Het
Zswim6 T C 13: 107,769,593 (GRCm38) noncoding transcript Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55,233,103 (GRCm38) missense probably benign 0.01
IGL01954:Gucy2g APN 19 55,198,691 (GRCm38) missense probably benign 0.01
IGL01969:Gucy2g APN 19 55,227,438 (GRCm38) missense probably benign 0.00
IGL02164:Gucy2g APN 19 55,238,023 (GRCm38) missense probably benign
IGL02534:Gucy2g APN 19 55,241,068 (GRCm38) missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55,206,177 (GRCm38) missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55,210,354 (GRCm38) missense probably benign 0.10
IGL03187:Gucy2g APN 19 55,231,052 (GRCm38) missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55,233,080 (GRCm38) missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55,237,782 (GRCm38) missense probably null 0.51
R0040:Gucy2g UTSW 19 55,217,302 (GRCm38) missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55,241,166 (GRCm38) missense probably benign
R0318:Gucy2g UTSW 19 55,237,798 (GRCm38) missense probably benign 0.00
R0576:Gucy2g UTSW 19 55,198,770 (GRCm38) missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55,203,087 (GRCm38) missense probably benign 0.00
R0962:Gucy2g UTSW 19 55,210,284 (GRCm38) nonsense probably null
R1348:Gucy2g UTSW 19 55,222,906 (GRCm38) missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55,215,036 (GRCm38) splice site probably benign
R1693:Gucy2g UTSW 19 55,222,926 (GRCm38) missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55,199,541 (GRCm38) missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55,210,309 (GRCm38) missense probably benign 0.34
R1830:Gucy2g UTSW 19 55,222,930 (GRCm38) missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55,210,237 (GRCm38) missense probably benign 0.20
R1927:Gucy2g UTSW 19 55,237,759 (GRCm38) missense probably benign 0.02
R1969:Gucy2g UTSW 19 55,233,053 (GRCm38) missense probably benign 0.42
R1969:Gucy2g UTSW 19 55,222,896 (GRCm38) missense possibly damaging 0.90
R2071:Gucy2g UTSW 19 55,222,340 (GRCm38) missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55,240,947 (GRCm38) missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55,210,276 (GRCm38) missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55,229,769 (GRCm38) missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55,237,837 (GRCm38) missense probably benign 0.08
R4407:Gucy2g UTSW 19 55,237,837 (GRCm38) missense probably benign 0.08
R4614:Gucy2g UTSW 19 55,202,147 (GRCm38) nonsense probably null
R4671:Gucy2g UTSW 19 55,238,068 (GRCm38) missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55,206,256 (GRCm38) missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55,226,053 (GRCm38) missense probably benign
R4969:Gucy2g UTSW 19 55,226,013 (GRCm38) missense probably benign
R5050:Gucy2g UTSW 19 55,240,935 (GRCm38) missense probably benign 0.05
R5059:Gucy2g UTSW 19 55,226,071 (GRCm38) missense probably benign 0.00
R5070:Gucy2g UTSW 19 55,229,787 (GRCm38) missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55,215,116 (GRCm38) missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55,215,116 (GRCm38) missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55,215,116 (GRCm38) missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55,198,701 (GRCm38) missense probably benign 0.00
R5536:Gucy2g UTSW 19 55,237,927 (GRCm38) missense probably benign 0.05
R5679:Gucy2g UTSW 19 55,231,079 (GRCm38) missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55,233,155 (GRCm38) missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55,215,131 (GRCm38) missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55,217,424 (GRCm38) missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55,227,513 (GRCm38) missense probably benign 0.01
R6378:Gucy2g UTSW 19 55,240,945 (GRCm38) missense probably benign 0.00
R6605:Gucy2g UTSW 19 55,241,028 (GRCm38) missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55,233,050 (GRCm38) missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55,210,332 (GRCm38) missense probably benign 0.01
R7078:Gucy2g UTSW 19 55,241,151 (GRCm38) missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55,206,293 (GRCm38) missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55,203,154 (GRCm38) missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55,206,340 (GRCm38) missense probably benign 0.38
R7583:Gucy2g UTSW 19 55,235,615 (GRCm38) missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55,228,152 (GRCm38) missense probably benign 0.02
R7880:Gucy2g UTSW 19 55,206,280 (GRCm38) missense probably damaging 1.00
R8442:Gucy2g UTSW 19 55,217,401 (GRCm38) missense probably benign 0.00
R8559:Gucy2g UTSW 19 55,210,354 (GRCm38) missense probably benign 0.10
R8970:Gucy2g UTSW 19 55,203,046 (GRCm38) missense possibly damaging 0.56
R8972:Gucy2g UTSW 19 55,237,974 (GRCm38) missense probably benign 0.17
R9085:Gucy2g UTSW 19 55,233,165 (GRCm38) nonsense probably null
R9390:Gucy2g UTSW 19 55,202,175 (GRCm38) missense probably null 1.00
R9462:Gucy2g UTSW 19 55,233,037 (GRCm38) critical splice donor site probably null
R9502:Gucy2g UTSW 19 55,210,384 (GRCm38) missense probably damaging 1.00
R9610:Gucy2g UTSW 19 55,206,173 (GRCm38) missense probably damaging 1.00
R9611:Gucy2g UTSW 19 55,206,173 (GRCm38) missense probably damaging 1.00
R9644:Gucy2g UTSW 19 55,231,105 (GRCm38) missense probably benign 0.05
Z1177:Gucy2g UTSW 19 55,210,377 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCACTGCATGTTGAATTG -3'
(R):5'- TGATCTCTGGGGACTCTTCAC -3'

Sequencing Primer
(F):5'- ATTGGTGTAAGTGAACTCCCAGCTC -3'
(R):5'- ACTCTCATATAAGTTCTGGGCACG -3'
Posted On 2016-10-06