Incidental Mutation 'R5533:Itga8'
ID 433730
Institutional Source Beutler Lab
Gene Symbol Itga8
Ensembl Gene ENSMUSG00000026768
Gene Name integrin alpha 8
Synonyms
MMRRC Submission 043091-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.870) question?
Stock # R5533 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 12111443-12306733 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12165161 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 816 (V816A)
Ref Sequence ENSEMBL: ENSMUSP00000028106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]
AlphaFold A2ARA8
Predicted Effect possibly damaging
Transcript: ENSMUST00000028106
AA Change: V816A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V816A

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
SCOP:d1m1xa2 643 780 2e-46 SMART
SCOP:d1m1xa3 784 1000 2e-80 SMART
transmembrane domain 1011 1033 N/A INTRINSIC
Pfam:Integrin_alpha 1034 1048 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172791
SMART Domains Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Int_alpha 52 112 8.48e-8 SMART
Int_alpha 197 244 4.8e1 SMART
Int_alpha 262 312 5.91e-7 SMART
Int_alpha 316 377 6.94e-13 SMART
Int_alpha 381 437 1.92e-15 SMART
Int_alpha 445 494 8.23e-6 SMART
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,918,911 (GRCm39) E429G probably damaging Het
Akap12 T A 10: 4,307,405 (GRCm39) V1405D probably damaging Het
Akap7 C T 10: 25,159,880 (GRCm39) D107N possibly damaging Het
Arfgef1 A G 1: 10,269,952 (GRCm39) probably null Het
Cacna1s T A 1: 136,026,113 (GRCm39) probably null Het
Ctsd T C 7: 141,931,070 (GRCm39) Q274R probably benign Het
Dysf G A 6: 84,163,453 (GRCm39) R1575Q probably damaging Het
Erich6b A T 14: 75,896,274 (GRCm39) L53F possibly damaging Het
Exoc6 A C 19: 37,582,218 (GRCm39) probably null Het
Fbxw19 A T 9: 109,315,133 (GRCm39) V143E probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fndc1 A G 17: 7,991,608 (GRCm39) F696S unknown Het
Foxa3 G T 7: 18,748,940 (GRCm39) Y102* probably null Het
Foxn1 A G 11: 78,256,792 (GRCm39) M301T probably damaging Het
Foxp2 C T 6: 15,197,119 (GRCm39) Q54* probably null Het
Glra1 T C 11: 55,423,208 (GRCm39) E117G possibly damaging Het
Glt1d1 A T 5: 127,768,095 (GRCm39) D234V probably damaging Het
Golm2 AGATGGTGATGGTG AGATGGTG 2: 121,756,178 (GRCm39) probably benign Het
Gulp1 T C 1: 44,812,441 (GRCm39) I137T probably damaging Het
Kdm4c G A 4: 74,233,886 (GRCm39) probably benign Het
Krtap19-2 A G 16: 88,670,996 (GRCm39) probably benign Het
Lcorl T C 5: 45,891,219 (GRCm39) N378S possibly damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mocos T C 18: 24,807,357 (GRCm39) L363P probably damaging Het
Mycbp2 G T 14: 103,520,081 (GRCm39) Y745* probably null Het
Nav3 A C 10: 109,719,539 (GRCm39) N141K possibly damaging Het
Ncor1 T C 11: 62,233,837 (GRCm39) N779S probably benign Het
Nebl G T 2: 17,398,079 (GRCm39) Y414* probably null Het
Nf1 T G 11: 79,336,615 (GRCm39) C1065G probably damaging Het
Nfib A G 4: 82,278,004 (GRCm39) V216A probably damaging Het
Nub1 A T 5: 24,907,379 (GRCm39) N354I possibly damaging Het
Nyap1 C T 5: 137,733,726 (GRCm39) V436I probably benign Het
Or5m11b A G 2: 85,805,797 (GRCm39) D70G possibly damaging Het
Or5p73 T C 7: 108,065,469 (GRCm39) F313L probably benign Het
Pde2a T A 7: 101,155,187 (GRCm39) M570K probably damaging Het
Pfas T C 11: 68,882,296 (GRCm39) S856G probably benign Het
Pkd1l2 T C 8: 117,794,855 (GRCm39) E368G probably benign Het
Ptf1a G A 2: 19,451,969 (GRCm39) V323M probably damaging Het
Ptprh T C 7: 4,552,504 (GRCm39) Y920C probably damaging Het
Sergef T A 7: 46,264,200 (GRCm39) D229V possibly damaging Het
Slc1a4 T C 11: 20,254,417 (GRCm39) K483R probably benign Het
Slc26a6 G A 9: 108,735,155 (GRCm39) R351H probably damaging Het
Slc6a19 G A 13: 73,833,948 (GRCm39) T370I possibly damaging Het
Smpd5 T C 15: 76,178,757 (GRCm39) S42P possibly damaging Het
Snx13 G A 12: 35,173,025 (GRCm39) probably null Het
Sox10 G A 15: 79,040,502 (GRCm39) S185L probably benign Het
Spata31e5 T A 1: 28,817,163 (GRCm39) I290F probably damaging Het
Srpk1 T C 17: 28,821,733 (GRCm39) Y227C probably damaging Het
Stambpl1 T A 19: 34,211,316 (GRCm39) probably null Het
Stk36 A G 1: 74,665,750 (GRCm39) R698G possibly damaging Het
Tas2r122 T A 6: 132,688,393 (GRCm39) T167S probably damaging Het
Tlr12 A G 4: 128,509,656 (GRCm39) S865P probably damaging Het
Trp53bp1 A G 2: 121,038,227 (GRCm39) L1537P probably damaging Het
Vstm2a C A 11: 16,213,125 (GRCm39) T170K possibly damaging Het
Xpo7 A T 14: 70,931,407 (GRCm39) F304I probably damaging Het
Zfp286 T C 11: 62,671,796 (GRCm39) probably benign Het
Zfp985 A T 4: 147,667,440 (GRCm39) K103* probably null Het
Other mutations in Itga8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Itga8 APN 2 12,260,777 (GRCm39) nonsense probably null
IGL00820:Itga8 APN 2 12,237,703 (GRCm39) missense possibly damaging 0.85
IGL01409:Itga8 APN 2 12,196,525 (GRCm39) missense probably benign
IGL01508:Itga8 APN 2 12,237,613 (GRCm39) missense possibly damaging 0.67
IGL01585:Itga8 APN 2 12,165,123 (GRCm39) splice site probably benign
IGL01590:Itga8 APN 2 12,165,144 (GRCm39) missense probably damaging 1.00
IGL01743:Itga8 APN 2 12,270,144 (GRCm39) missense probably benign 0.04
IGL02634:Itga8 APN 2 12,145,289 (GRCm39) missense possibly damaging 0.55
IGL02805:Itga8 APN 2 12,194,291 (GRCm39) missense possibly damaging 0.83
IGL03200:Itga8 APN 2 12,196,010 (GRCm39) missense probably benign 0.00
IGL03218:Itga8 APN 2 12,115,836 (GRCm39) missense possibly damaging 0.77
IGL03248:Itga8 APN 2 12,137,327 (GRCm39) missense probably benign 0.20
PIT4576001:Itga8 UTSW 2 12,234,903 (GRCm39) missense probably benign 0.19
R0196:Itga8 UTSW 2 12,209,540 (GRCm39) critical splice donor site probably null
R0356:Itga8 UTSW 2 12,187,532 (GRCm39) missense possibly damaging 0.73
R0466:Itga8 UTSW 2 12,237,697 (GRCm39) missense probably damaging 1.00
R0530:Itga8 UTSW 2 12,196,627 (GRCm39) missense probably damaging 0.99
R0715:Itga8 UTSW 2 12,196,053 (GRCm39) splice site probably benign
R0800:Itga8 UTSW 2 12,198,362 (GRCm39) missense possibly damaging 0.95
R0881:Itga8 UTSW 2 12,267,003 (GRCm39) splice site probably null
R1675:Itga8 UTSW 2 12,204,974 (GRCm39) missense probably damaging 0.99
R1758:Itga8 UTSW 2 12,270,144 (GRCm39) missense possibly damaging 0.83
R1939:Itga8 UTSW 2 12,305,657 (GRCm39) missense probably damaging 1.00
R2187:Itga8 UTSW 2 12,199,231 (GRCm39) missense possibly damaging 0.60
R2295:Itga8 UTSW 2 12,187,520 (GRCm39) missense probably benign 0.38
R2356:Itga8 UTSW 2 12,204,952 (GRCm39) missense probably benign
R2371:Itga8 UTSW 2 12,258,277 (GRCm39) missense probably damaging 1.00
R2412:Itga8 UTSW 2 12,306,526 (GRCm39) missense probably benign
R2440:Itga8 UTSW 2 12,183,491 (GRCm39) missense possibly damaging 0.70
R2848:Itga8 UTSW 2 12,165,215 (GRCm39) missense probably damaging 0.98
R3730:Itga8 UTSW 2 12,198,321 (GRCm39) missense possibly damaging 0.92
R3933:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R3982:Itga8 UTSW 2 12,305,774 (GRCm39) missense possibly damaging 0.92
R4513:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4514:Itga8 UTSW 2 12,187,547 (GRCm39) missense probably benign 0.01
R4660:Itga8 UTSW 2 12,270,069 (GRCm39) missense probably damaging 1.00
R4890:Itga8 UTSW 2 12,198,102 (GRCm39) splice site probably benign
R5619:Itga8 UTSW 2 12,270,139 (GRCm39) missense probably damaging 1.00
R5720:Itga8 UTSW 2 12,115,898 (GRCm39) missense probably damaging 0.99
R5749:Itga8 UTSW 2 12,266,889 (GRCm39) missense probably damaging 1.00
R5930:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R5954:Itga8 UTSW 2 12,137,297 (GRCm39) missense probably damaging 0.99
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6035:Itga8 UTSW 2 12,196,525 (GRCm39) missense probably benign
R6211:Itga8 UTSW 2 12,198,320 (GRCm39) missense probably damaging 1.00
R6337:Itga8 UTSW 2 12,258,280 (GRCm39) nonsense probably null
R6442:Itga8 UTSW 2 12,234,954 (GRCm39) missense probably benign 0.00
R6491:Itga8 UTSW 2 12,209,587 (GRCm39) missense probably damaging 1.00
R6543:Itga8 UTSW 2 12,306,455 (GRCm39) missense probably damaging 0.99
R6574:Itga8 UTSW 2 12,234,972 (GRCm39) missense probably benign 0.17
R6760:Itga8 UTSW 2 12,306,451 (GRCm39) missense probably damaging 1.00
R6858:Itga8 UTSW 2 12,204,892 (GRCm39) missense probably benign 0.00
R6943:Itga8 UTSW 2 12,160,182 (GRCm39) critical splice donor site probably null
R7048:Itga8 UTSW 2 12,115,895 (GRCm39) missense probably damaging 0.99
R7203:Itga8 UTSW 2 12,234,906 (GRCm39) missense possibly damaging 0.77
R7266:Itga8 UTSW 2 12,237,712 (GRCm39) missense probably damaging 1.00
R7323:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R7540:Itga8 UTSW 2 12,115,848 (GRCm39) missense possibly damaging 0.82
R7637:Itga8 UTSW 2 12,113,998 (GRCm39) missense probably damaging 1.00
R7748:Itga8 UTSW 2 12,235,050 (GRCm39) missense possibly damaging 0.80
R7848:Itga8 UTSW 2 12,196,548 (GRCm39) missense probably damaging 0.99
R8031:Itga8 UTSW 2 12,160,297 (GRCm39) missense probably benign
R8077:Itga8 UTSW 2 12,247,244 (GRCm39) missense probably benign 0.09
R8757:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8759:Itga8 UTSW 2 12,266,940 (GRCm39) missense probably damaging 1.00
R8772:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8773:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Itga8 UTSW 2 12,187,495 (GRCm39) missense probably damaging 1.00
R8808:Itga8 UTSW 2 12,137,328 (GRCm39) nonsense probably null
R8898:Itga8 UTSW 2 12,145,206 (GRCm39) missense probably benign 0.05
R8962:Itga8 UTSW 2 12,196,045 (GRCm39) missense possibly damaging 0.94
R9056:Itga8 UTSW 2 12,235,019 (GRCm39) missense possibly damaging 0.84
R9155:Itga8 UTSW 2 12,194,330 (GRCm39) missense probably benign
R9354:Itga8 UTSW 2 12,237,668 (GRCm39) missense possibly damaging 0.94
R9563:Itga8 UTSW 2 12,165,219 (GRCm39) missense possibly damaging 0.83
R9589:Itga8 UTSW 2 12,237,701 (GRCm39) missense probably damaging 1.00
R9663:Itga8 UTSW 2 12,196,580 (GRCm39) missense probably benign 0.00
Z1176:Itga8 UTSW 2 12,306,643 (GRCm39) start gained probably benign
Z1176:Itga8 UTSW 2 12,266,947 (GRCm39) missense probably benign 0.01
Z1176:Itga8 UTSW 2 12,252,329 (GRCm39) missense probably damaging 1.00
Z1177:Itga8 UTSW 2 12,305,744 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCACAAATTACAAAGGTTGGACC -3'
(R):5'- CAACTTGCTTCCTTTGAAATCAGTG -3'

Sequencing Primer
(F):5'- AAGAGCATTGGTCACTCTTCCAG -3'
(R):5'- TCAGTGTAATATATGAAACCAGTTGC -3'
Posted On 2016-10-06