Mutagenetix > Incidental Mutation

Incidental Mutation 'R5533:Itga8'

433730

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

043091-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R5533 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12160350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 816 (V816A)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028106
AA Change: V816A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: V816A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Coding Region Coverage

1x: 98.4%
3x: 97.1%
10x: 94.5%
20x: 88.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agap2	A	G	10: 127,083,042	E429G	probably damaging	Het
Akap12	T	A	10: 4,357,405	V1405D	probably damaging	Het
Akap7	C	T	10: 25,283,982	D107N	possibly damaging	Het
Arfgef1	A	G	1: 10,199,727		probably null	Het
Cacna1s	T	A	1: 136,098,375		probably null	Het
Casc4	AGATGGTGATGGTG	AGATGGTG	2: 121,925,697		probably benign	Het
Ctsd	T	C	7: 142,377,333	Q274R	probably benign	Het
Dysf	G	A	6: 84,186,471	R1575Q	probably damaging	Het
Erich6b	A	T	14: 75,658,834	L53F	possibly damaging	Het
Exoc6	A	C	19: 37,593,770		probably null	Het
Fbxw19	A	T	9: 109,486,065	V143E	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fndc1	A	G	17: 7,772,776	F696S	unknown	Het
Foxa3	G	T	7: 19,015,015	Y102*	probably null	Het
Foxn1	A	G	11: 78,365,966	M301T	probably damaging	Het
Foxp2	C	T	6: 15,197,120	Q54*	probably null	Het
Glra1	T	C	11: 55,532,382	E117G	possibly damaging	Het
Glt1d1	A	T	5: 127,691,031	D234V	probably damaging	Het
Gm597	T	A	1: 28,778,082	I290F	probably damaging	Het
Gulp1	T	C	1: 44,773,281	I137T	probably damaging	Het
Kdm4c	G	A	4: 74,315,649		probably benign	Het
Krtap19-2	A	G	16: 88,874,108		probably benign	Het
Lcorl	T	C	5: 45,733,877	N378S	possibly damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mocos	T	C	18: 24,674,300	L363P	probably damaging	Het
Mycbp2	G	T	14: 103,282,645	Y745*	probably null	Het
Nav3	A	C	10: 109,883,678	N141K	possibly damaging	Het
Ncor1	T	C	11: 62,343,011	N779S	probably benign	Het
Nebl	G	T	2: 17,393,268	Y414*	probably null	Het
Nf1	T	G	11: 79,445,789	C1065G	probably damaging	Het
Nfib	A	G	4: 82,359,767	V216A	probably damaging	Het
Nub1	A	T	5: 24,702,381	N354I	possibly damaging	Het
Nyap1	C	T	5: 137,735,464	V436I	probably benign	Het
Olfr1029	A	G	2: 85,975,453	D70G	possibly damaging	Het
Olfr498	T	C	7: 108,466,262	F313L	probably benign	Het
Pde2a	T	A	7: 101,505,980	M570K	probably damaging	Het
Pfas	T	C	11: 68,991,470	S856G	probably benign	Het
Pkd1l2	T	C	8: 117,068,116	E368G	probably benign	Het
Ptf1a	G	A	2: 19,447,158	V323M	probably damaging	Het
Ptprh	T	C	7: 4,549,505	Y920C	probably damaging	Het
Sergef	T	A	7: 46,614,776	D229V	possibly damaging	Het
Slc1a4	T	C	11: 20,304,417	K483R	probably benign	Het
Slc26a6	G	A	9: 108,857,956	R351H	probably damaging	Het
Slc6a19	G	A	13: 73,685,829	T370I	possibly damaging	Het
Smpd5	T	C	15: 76,294,557	S42P	possibly damaging	Het
Snx13	G	A	12: 35,123,026		probably null	Het
Sox10	G	A	15: 79,156,302	S185L	probably benign	Het
Srpk1	T	C	17: 28,602,759	Y227C	probably damaging	Het
Stambpl1	T	A	19: 34,233,916		probably null	Het
Stk36	A	G	1: 74,626,591	R698G	possibly damaging	Het
Tas2r122	T	A	6: 132,711,430	T167S	probably damaging	Het
Tlr12	A	G	4: 128,615,863	S865P	probably damaging	Het
Trp53bp1	A	G	2: 121,207,746	L1537P	probably damaging	Het
Vstm2a	C	A	11: 16,263,125	T170K	possibly damaging	Het
Xpo7	A	T	14: 70,693,967	F304I	probably damaging	Het
Zfp286	T	C	11: 62,780,970		probably benign	Het
Zfp985	A	T	4: 147,582,983	K103*	probably null	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8898:Itga8	UTSW	2	12140395	missense	probably benign	0.05
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- AGCACAAATTACAAAGGTTGGACC -3'
(R):5'- CAACTTGCTTCCTTTGAAATCAGTG -3'

Sequencing Primer
(F):5'- AAGAGCATTGGTCACTCTTCCAG -3'
(R):5'- TCAGTGTAATATATGAAACCAGTTGC -3'

Posted On

2016-10-06