Incidental Mutation 'R5533:Trp53bp1'
ID433734
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121207746 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1537 (L1537P)
Ref Sequence ENSEMBL: ENSMUSP00000106278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000154426]
Predicted Effect probably damaging
Transcript: ENSMUST00000110647
AA Change: L1487P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: L1487P

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110648
AA Change: L1537P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: L1537P

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124411
Predicted Effect probably benign
Transcript: ENSMUST00000124554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140582
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147554
Predicted Effect probably damaging
Transcript: ENSMUST00000154426
AA Change: L6P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909
AA Change: L6P

DomainStartEndE-ValueType
Pfam:53-BP1_Tudor 1 70 2.5e-44 PFAM
low complexity region 100 120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7278:Trp53bp1 UTSW 2 121199035 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGTCAATGGCCAGGGTAAG -3'
(R):5'- GCTTGGATTCCTCATCTTCAGG -3'

Sequencing Primer
(F):5'- AATAGGAGTGGAATCTCTGACTTG -3'
(R):5'- CTCATCTTCAGGAAACAGCTTTGTGG -3'
Posted On2016-10-06