Incidental Mutation 'R5533:Nyap1'
ID 433743
Institutional Source Beutler Lab
Gene Symbol Nyap1
Ensembl Gene ENSMUSG00000045348
Gene Name neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms 6430598A04Rik, Nyap1
MMRRC Submission 043091-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R5533 (G1)
Quality Score 115
Status Not validated
Chromosome 5
Chromosomal Location 137729144-137739430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 137733726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 436 (V436I)
Ref Sequence ENSEMBL: ENSMUSP00000114694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061789] [ENSMUST00000118326] [ENSMUST00000149512] [ENSMUST00000212152]
AlphaFold Q6PFX7
Predicted Effect probably benign
Transcript: ENSMUST00000061789
AA Change: V436I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058217
Gene: ENSMUSG00000045348
AA Change: V436I

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118326
AA Change: V436I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113397
Gene: ENSMUSG00000045348
AA Change: V436I

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 1.5e-127 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 833 1.7e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149512
AA Change: V436I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114694
Gene: ENSMUSG00000045348
AA Change: V436I

DomainStartEndE-ValueType
Pfam:NYAP_N 15 411 7.1e-128 PFAM
low complexity region 431 452 N/A INTRINSIC
Pfam:NYAP_C 528 771 1.9e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212152
AA Change: V436I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Triple KO of Nyap1, Nyap2 and Myo16 results in decreased brain weight and cortex and striatum size and reduced neurite length in cortical neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 126,918,911 (GRCm39) E429G probably damaging Het
Akap12 T A 10: 4,307,405 (GRCm39) V1405D probably damaging Het
Akap7 C T 10: 25,159,880 (GRCm39) D107N possibly damaging Het
Arfgef1 A G 1: 10,269,952 (GRCm39) probably null Het
Cacna1s T A 1: 136,026,113 (GRCm39) probably null Het
Ctsd T C 7: 141,931,070 (GRCm39) Q274R probably benign Het
Dysf G A 6: 84,163,453 (GRCm39) R1575Q probably damaging Het
Erich6b A T 14: 75,896,274 (GRCm39) L53F possibly damaging Het
Exoc6 A C 19: 37,582,218 (GRCm39) probably null Het
Fbxw19 A T 9: 109,315,133 (GRCm39) V143E probably benign Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Fndc1 A G 17: 7,991,608 (GRCm39) F696S unknown Het
Foxa3 G T 7: 18,748,940 (GRCm39) Y102* probably null Het
Foxn1 A G 11: 78,256,792 (GRCm39) M301T probably damaging Het
Foxp2 C T 6: 15,197,119 (GRCm39) Q54* probably null Het
Glra1 T C 11: 55,423,208 (GRCm39) E117G possibly damaging Het
Glt1d1 A T 5: 127,768,095 (GRCm39) D234V probably damaging Het
Golm2 AGATGGTGATGGTG AGATGGTG 2: 121,756,178 (GRCm39) probably benign Het
Gulp1 T C 1: 44,812,441 (GRCm39) I137T probably damaging Het
Itga8 A G 2: 12,165,161 (GRCm39) V816A possibly damaging Het
Kdm4c G A 4: 74,233,886 (GRCm39) probably benign Het
Krtap19-2 A G 16: 88,670,996 (GRCm39) probably benign Het
Lcorl T C 5: 45,891,219 (GRCm39) N378S possibly damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Mocos T C 18: 24,807,357 (GRCm39) L363P probably damaging Het
Mycbp2 G T 14: 103,520,081 (GRCm39) Y745* probably null Het
Nav3 A C 10: 109,719,539 (GRCm39) N141K possibly damaging Het
Ncor1 T C 11: 62,233,837 (GRCm39) N779S probably benign Het
Nebl G T 2: 17,398,079 (GRCm39) Y414* probably null Het
Nf1 T G 11: 79,336,615 (GRCm39) C1065G probably damaging Het
Nfib A G 4: 82,278,004 (GRCm39) V216A probably damaging Het
Nub1 A T 5: 24,907,379 (GRCm39) N354I possibly damaging Het
Or5m11b A G 2: 85,805,797 (GRCm39) D70G possibly damaging Het
Or5p73 T C 7: 108,065,469 (GRCm39) F313L probably benign Het
Pde2a T A 7: 101,155,187 (GRCm39) M570K probably damaging Het
Pfas T C 11: 68,882,296 (GRCm39) S856G probably benign Het
Pkd1l2 T C 8: 117,794,855 (GRCm39) E368G probably benign Het
Ptf1a G A 2: 19,451,969 (GRCm39) V323M probably damaging Het
Ptprh T C 7: 4,552,504 (GRCm39) Y920C probably damaging Het
Sergef T A 7: 46,264,200 (GRCm39) D229V possibly damaging Het
Slc1a4 T C 11: 20,254,417 (GRCm39) K483R probably benign Het
Slc26a6 G A 9: 108,735,155 (GRCm39) R351H probably damaging Het
Slc6a19 G A 13: 73,833,948 (GRCm39) T370I possibly damaging Het
Smpd5 T C 15: 76,178,757 (GRCm39) S42P possibly damaging Het
Snx13 G A 12: 35,173,025 (GRCm39) probably null Het
Sox10 G A 15: 79,040,502 (GRCm39) S185L probably benign Het
Spata31e5 T A 1: 28,817,163 (GRCm39) I290F probably damaging Het
Srpk1 T C 17: 28,821,733 (GRCm39) Y227C probably damaging Het
Stambpl1 T A 19: 34,211,316 (GRCm39) probably null Het
Stk36 A G 1: 74,665,750 (GRCm39) R698G possibly damaging Het
Tas2r122 T A 6: 132,688,393 (GRCm39) T167S probably damaging Het
Tlr12 A G 4: 128,509,656 (GRCm39) S865P probably damaging Het
Trp53bp1 A G 2: 121,038,227 (GRCm39) L1537P probably damaging Het
Vstm2a C A 11: 16,213,125 (GRCm39) T170K possibly damaging Het
Xpo7 A T 14: 70,931,407 (GRCm39) F304I probably damaging Het
Zfp286 T C 11: 62,671,796 (GRCm39) probably benign Het
Zfp985 A T 4: 147,667,440 (GRCm39) K103* probably null Het
Other mutations in Nyap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Nyap1 APN 5 137,736,346 (GRCm39) missense probably damaging 1.00
IGL02211:Nyap1 APN 5 137,737,937 (GRCm39) missense probably damaging 0.99
IGL02658:Nyap1 APN 5 137,733,746 (GRCm39) missense probably damaging 0.99
IGL03493:Nyap1 APN 5 137,733,278 (GRCm39) missense probably damaging 1.00
R0180:Nyap1 UTSW 5 137,736,283 (GRCm39) missense probably damaging 1.00
R0731:Nyap1 UTSW 5 137,733,560 (GRCm39) missense probably damaging 1.00
R1215:Nyap1 UTSW 5 137,733,395 (GRCm39) nonsense probably null
R1741:Nyap1 UTSW 5 137,731,387 (GRCm39) missense probably damaging 1.00
R1953:Nyap1 UTSW 5 137,733,294 (GRCm39) missense probably benign 0.01
R2006:Nyap1 UTSW 5 137,733,953 (GRCm39) missense possibly damaging 0.81
R2131:Nyap1 UTSW 5 137,731,943 (GRCm39) intron probably null
R2244:Nyap1 UTSW 5 137,733,576 (GRCm39) missense probably damaging 1.00
R4581:Nyap1 UTSW 5 137,734,284 (GRCm39) missense probably damaging 1.00
R4857:Nyap1 UTSW 5 137,733,840 (GRCm39) missense probably damaging 0.98
R5151:Nyap1 UTSW 5 137,734,376 (GRCm39) missense probably damaging 0.99
R5695:Nyap1 UTSW 5 137,733,246 (GRCm39) missense probably damaging 1.00
R7201:Nyap1 UTSW 5 137,734,524 (GRCm39) missense probably damaging 1.00
R7210:Nyap1 UTSW 5 137,736,244 (GRCm39) missense probably damaging 1.00
R7374:Nyap1 UTSW 5 137,733,791 (GRCm39) missense probably damaging 1.00
R7434:Nyap1 UTSW 5 137,734,530 (GRCm39) missense probably damaging 1.00
R7658:Nyap1 UTSW 5 137,731,236 (GRCm39) missense probably benign
R7870:Nyap1 UTSW 5 137,733,658 (GRCm39) nonsense probably null
R7913:Nyap1 UTSW 5 137,733,231 (GRCm39) missense probably damaging 1.00
R8278:Nyap1 UTSW 5 137,730,077 (GRCm39) missense probably damaging 1.00
R8422:Nyap1 UTSW 5 137,734,083 (GRCm39) missense probably benign 0.01
R9145:Nyap1 UTSW 5 137,736,175 (GRCm39) missense probably benign
R9367:Nyap1 UTSW 5 137,734,248 (GRCm39) missense probably damaging 1.00
R9441:Nyap1 UTSW 5 137,733,194 (GRCm39) missense probably benign 0.02
R9568:Nyap1 UTSW 5 137,733,394 (GRCm39) nonsense probably null
R9680:Nyap1 UTSW 5 137,733,840 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATTCCATGAAGTACTGAAATCTCC -3'
(R):5'- TGATGGGGTCTCAAGGCTAC -3'

Sequencing Primer
(F):5'- CATGAAGTACTGAAATCTCCTCTGTC -3'
(R):5'- TCAAGGCTACCGGTCCTCTG -3'
Posted On 2016-10-06