Incidental Mutation 'R5533:Akap12'
ID433758
Institutional Source Beutler Lab
Gene Symbol Akap12
Ensembl Gene ENSMUSG00000038587
Gene NameA kinase (PRKA) anchor protein (gravin) 12
SynonymsSSeCKS, Tsga12, Srcs5
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location4266380-4359470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4357405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1405 (V1405D)
Ref Sequence ENSEMBL: ENSMUSP00000150261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]
Predicted Effect probably damaging
Transcript: ENSMUST00000045730
AA Change: V1510D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: V1510D

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 151 171 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
internal_repeat_1 212 279 3.2e-5 PROSPERO
coiled coil region 304 331 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 497 526 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
Pfam:WSK 591 619 2e-15 PFAM
low complexity region 626 637 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
low complexity region 700 711 N/A INTRINSIC
Pfam:WSK 738 766 2.3e-15 PFAM
Pfam:WSK 779 807 6.2e-11 PFAM
low complexity region 951 973 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
internal_repeat_1 1197 1265 3.2e-5 PROSPERO
low complexity region 1303 1312 N/A INTRINSIC
Pfam:RII_binding_1 1501 1518 4.2e-7 PFAM
coiled coil region 1651 1676 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215696
AA Change: V1405D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216139
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Sox10 G A 15: 79,156,302 S185L probably benign Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Akap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Akap12 APN 10 4357164 missense probably benign 0.09
IGL01306:Akap12 APN 10 4353273 missense probably benign 0.04
IGL01360:Akap12 APN 10 4357537 missense probably benign 0.02
IGL01455:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL01458:Akap12 APN 10 4354060 missense probably damaging 1.00
IGL01465:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL02348:Akap12 APN 10 4354722 missense probably damaging 1.00
IGL02425:Akap12 APN 10 4356034 missense possibly damaging 0.67
IGL02502:Akap12 APN 10 4353163 missense probably damaging 1.00
IGL02736:Akap12 APN 10 4355637 missense probably benign
IGL02969:Akap12 APN 10 4354864 missense probably damaging 1.00
IGL03345:Akap12 APN 10 4356697 missense probably benign 0.42
ANU23:Akap12 UTSW 10 4353273 missense probably benign 0.04
FR4976:Akap12 UTSW 10 4353837 small insertion probably benign
R0004:Akap12 UTSW 10 4353218 missense possibly damaging 0.56
R0004:Akap12 UTSW 10 4353220 missense probably damaging 1.00
R0207:Akap12 UTSW 10 4353333 missense probably damaging 1.00
R0580:Akap12 UTSW 10 4354741 missense possibly damaging 0.91
R0675:Akap12 UTSW 10 4353315 missense probably benign 0.06
R1248:Akap12 UTSW 10 4353847 missense probably benign 0.11
R1338:Akap12 UTSW 10 4313773 missense possibly damaging 0.95
R1448:Akap12 UTSW 10 4355475 missense probably benign 0.22
R1458:Akap12 UTSW 10 4353693 missense probably damaging 1.00
R1521:Akap12 UTSW 10 4354804 missense probably benign 0.02
R1585:Akap12 UTSW 10 4353640 missense probably benign 0.11
R1725:Akap12 UTSW 10 4353942 missense probably damaging 1.00
R1756:Akap12 UTSW 10 4357574 missense probably benign 0.04
R1914:Akap12 UTSW 10 4356685 missense probably benign 0.01
R1978:Akap12 UTSW 10 4313855 missense probably benign 0.06
R2032:Akap12 UTSW 10 4356673 missense possibly damaging 0.50
R2041:Akap12 UTSW 10 4356489 missense probably benign 0.01
R3009:Akap12 UTSW 10 4357891 missense probably benign 0.06
R3872:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3874:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3875:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3944:Akap12 UTSW 10 4357347 missense probably benign 0.00
R4612:Akap12 UTSW 10 4354456 missense probably damaging 1.00
R4889:Akap12 UTSW 10 4356535 missense probably damaging 0.97
R5043:Akap12 UTSW 10 4355047 missense probably damaging 1.00
R5176:Akap12 UTSW 10 4353947 missense probably benign 0.19
R5278:Akap12 UTSW 10 4354792 missense probably benign 0.02
R5320:Akap12 UTSW 10 4357291 missense probably benign 0.00
R5443:Akap12 UTSW 10 4355576 missense probably damaging 1.00
R6133:Akap12 UTSW 10 4355178 missense probably benign 0.05
R6142:Akap12 UTSW 10 4313740 splice site probably null
R6190:Akap12 UTSW 10 4356268 missense possibly damaging 0.92
R6458:Akap12 UTSW 10 4355148 missense probably damaging 1.00
R6562:Akap12 UTSW 10 4356141 nonsense probably null
R6701:Akap12 UTSW 10 4355243 missense probably damaging 1.00
R6828:Akap12 UTSW 10 4354606 missense probably damaging 0.96
R6991:Akap12 UTSW 10 4357122 nonsense probably null
R7023:Akap12 UTSW 10 4356895 missense probably benign 0.05
R7102:Akap12 UTSW 10 4353226 missense probably damaging 1.00
R7483:Akap12 UTSW 10 4353967 missense probably benign 0.00
R7538:Akap12 UTSW 10 4353213 missense probably damaging 1.00
R7664:Akap12 UTSW 10 4353748 missense probably damaging 1.00
R7704:Akap12 UTSW 10 4356082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAACTCCTGCTCCTGAAAGC -3'
(R):5'- GAAACCGCAAGTCCTTCCTG -3'

Sequencing Primer
(F):5'- TGCTCCTGAAAGCATCCTAC -3'
(R):5'- ACGGCACTGAGTGTTCCATC -3'
Posted On2016-10-06