Incidental Mutation 'R5533:Sox10'
ID433777
Institutional Source Beutler Lab
Gene Symbol Sox10
Ensembl Gene ENSMUSG00000033006
Gene NameSRY (sex determining region Y)-box 10
SynonymsSox21
MMRRC Submission 043091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5533 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79154908-79165240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 79156302 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 185 (S185L)
Ref Sequence ENSEMBL: ENSMUSP00000155639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040019] [ENSMUST00000040077] [ENSMUST00000229973] [ENSMUST00000230261] [ENSMUST00000230271] [ENSMUST00000230532]
Predicted Effect probably benign
Transcript: ENSMUST00000040019
AA Change: S346L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000039466
Gene: ENSMUSG00000033006
AA Change: S346L

DomainStartEndE-ValueType
Pfam:Sox_N 12 93 1.8e-31 PFAM
HMG 103 173 8.16e-27 SMART
low complexity region 183 205 N/A INTRINSIC
low complexity region 238 245 N/A INTRINSIC
low complexity region 310 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040077
SMART Domains Protein: ENSMUSP00000043566
Gene: ENSMUSG00000033020

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
Pfam:RNA_pol_Rpb6 51 104 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229762
Predicted Effect probably benign
Transcript: ENSMUST00000229973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229978
Predicted Effect probably benign
Transcript: ENSMUST00000230261
AA Change: S185L

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230271
Predicted Effect probably benign
Transcript: ENSMUST00000230532
AA Change: S346L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 88.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations lack peripheral glial cells, melanocytes, and autonomic and enteric neurons, and die neonatally or sooner. Heterozygotes exhibit white spotting and megacolon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap2 A G 10: 127,083,042 E429G unknown Het
Akap12 T A 10: 4,357,405 V1405D probably damaging Het
Akap7 C T 10: 25,283,982 D107N possibly damaging Het
Arfgef1 A G 1: 10,199,727 probably null Het
Cacna1s T A 1: 136,098,375 probably null Het
Casc4 AGATGGTGATGGTG AGATGGTG 2: 121,925,697 probably benign Het
Ctsd T C 7: 142,377,333 Q274R probably benign Het
Dysf G A 6: 84,186,471 R1575Q probably damaging Het
Erich6b A T 14: 75,658,834 L53F possibly damaging Het
Exoc6 A C 19: 37,593,770 probably null Het
Fbxw19 A T 9: 109,486,065 V143E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fndc1 A G 17: 7,772,776 F696S unknown Het
Foxa3 G T 7: 19,015,015 Y102* probably null Het
Foxn1 A G 11: 78,365,966 M301T probably damaging Het
Foxp2 C T 6: 15,197,120 Q54* probably null Het
Glra1 T C 11: 55,532,382 E117G possibly damaging Het
Glt1d1 A T 5: 127,691,031 D234V probably damaging Het
Gm597 T A 1: 28,778,082 I290F probably damaging Het
Gulp1 T C 1: 44,773,281 I137T probably damaging Het
Itga8 A G 2: 12,160,350 V816A possibly damaging Het
Kdm4c G A 4: 74,315,649 probably benign Het
Krtap19-2 A G 16: 88,874,108 probably benign Het
Lcorl T C 5: 45,733,877 N378S possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mocos T C 18: 24,674,300 L363P probably damaging Het
Mycbp2 G T 14: 103,282,645 Y745* probably null Het
Nav3 A C 10: 109,883,678 N141K possibly damaging Het
Ncor1 T C 11: 62,343,011 N779S probably benign Het
Nebl G T 2: 17,393,268 Y414* probably null Het
Nf1 T G 11: 79,445,789 C1065G probably damaging Het
Nfib A G 4: 82,359,767 V216A probably damaging Het
Nub1 A T 5: 24,702,381 N354I possibly damaging Het
Nyap1 C T 5: 137,735,464 V436I probably benign Het
Olfr1029 A G 2: 85,975,453 D70G possibly damaging Het
Olfr498 T C 7: 108,466,262 F313L probably benign Het
Pde2a T A 7: 101,505,980 M570K probably damaging Het
Pfas T C 11: 68,991,470 S856G probably benign Het
Pkd1l2 T C 8: 117,068,116 E368G probably benign Het
Ptf1a G A 2: 19,447,158 V323M probably damaging Het
Ptprh T C 7: 4,549,505 Y920C probably damaging Het
Sergef T A 7: 46,614,776 D229V possibly damaging Het
Slc1a4 T C 11: 20,304,417 K483R probably benign Het
Slc26a6 G A 9: 108,857,956 R351H probably damaging Het
Slc6a19 G A 13: 73,685,829 T370I possibly damaging Het
Smpd5 T C 15: 76,294,557 S42P possibly damaging Het
Snx13 G A 12: 35,123,026 probably null Het
Srpk1 T C 17: 28,602,759 Y227C probably damaging Het
Stambpl1 T A 19: 34,233,916 probably null Het
Stk36 A G 1: 74,626,591 R698G possibly damaging Het
Tas2r122 T A 6: 132,711,430 T167S probably damaging Het
Tlr12 A G 4: 128,615,863 S865P probably damaging Het
Trp53bp1 A G 2: 121,207,746 L1537P probably damaging Het
Vstm2a C A 11: 16,263,125 T170K possibly damaging Het
Xpo7 A T 14: 70,693,967 F304I probably damaging Het
Zfp286 T C 11: 62,780,970 probably benign Het
Zfp985 A T 4: 147,582,983 K103* probably null Het
Other mutations in Sox10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Sox10 APN 15 79156339 missense probably benign 0.24
IGL01693:Sox10 APN 15 79156273 missense possibly damaging 0.85
IGL02137:Sox10 APN 15 79159193 missense probably benign 0.01
Dalmatian UTSW 15 79163324 missense probably damaging 1.00
Kat UTSW 15 79163319 missense probably damaging 1.00
R0479:Sox10 UTSW 15 79163319 missense probably damaging 1.00
R0589:Sox10 UTSW 15 79163285 splice site probably benign
R0624:Sox10 UTSW 15 79159386 missense possibly damaging 0.90
R0679:Sox10 UTSW 15 79156588 missense probably benign 0.00
R0835:Sox10 UTSW 15 79156441 missense probably damaging 1.00
R1517:Sox10 UTSW 15 79159178 missense probably benign 0.00
R1635:Sox10 UTSW 15 79156460 missense probably damaging 1.00
R4089:Sox10 UTSW 15 79156363 missense possibly damaging 0.90
R5883:Sox10 UTSW 15 79156263 missense probably damaging 1.00
R6742:Sox10 UTSW 15 79156476 missense probably damaging 1.00
R7457:Sox10 UTSW 15 79156139 missense probably benign 0.06
R7514:Sox10 UTSW 15 79156221 missense probably benign 0.01
X0062:Sox10 UTSW 15 79156030 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCATGGCCATAATAGGGTC -3'
(R):5'- CCACGAGGTAATGTCCAACATGG -3'

Sequencing Primer
(F):5'- CCATAATAGGGTCCTGAGGGCTG -3'
(R):5'- CATGGAAACCTTTGATGTGACTGAGC -3'
Posted On2016-10-06