Incidental Mutation 'R5471:Gpr1'
ID433786
Institutional Source Beutler Lab
Gene Symbol Gpr1
Ensembl Gene ENSMUSG00000046856
Gene NameG protein-coupled receptor 1
Synonyms
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63182691-63214543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 63183899 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 59 (V59G)
Ref Sequence ENSEMBL: ENSMUSP00000051417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027108] [ENSMUST00000050536] [ENSMUST00000129339] [ENSMUST00000135877] [ENSMUST00000142062] [ENSMUST00000188524]
Predicted Effect probably benign
Transcript: ENSMUST00000027108
Predicted Effect probably damaging
Transcript: ENSMUST00000050536
AA Change: V59G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051417
Gene: ENSMUSG00000046856
AA Change: V59G

DomainStartEndE-ValueType
Pfam:7tm_1 55 302 3.9e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082668
Predicted Effect probably benign
Transcript: ENSMUST00000129339
SMART Domains Protein: ENSMUSP00000116492
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 103 130 2.53e-4 SMART
EF1_GNE 139 225 3.86e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135877
SMART Domains Protein: ENSMUSP00000137671
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142062
Predicted Effect probably benign
Transcript: ENSMUST00000188524
SMART Domains Protein: ENSMUSP00000140895
Gene: ENSMUSG00000025967

DomainStartEndE-ValueType
EF-1_beta_acid 62 89 1.2e-8 SMART
EF1_GNE 98 184 2.9e-48 SMART
Meta Mutation Damage Score 0.8623 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Gpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Gpr1 APN 1 63183338 missense probably damaging 0.99
IGL01086:Gpr1 APN 1 63183491 missense probably benign 0.01
IGL01490:Gpr1 APN 1 63183296 missense probably damaging 0.99
IGL02409:Gpr1 APN 1 63183716 missense probably damaging 1.00
IGL02426:Gpr1 APN 1 63183668 missense probably damaging 0.97
R0218:Gpr1 UTSW 1 63183531 missense probably benign 0.25
R2088:Gpr1 UTSW 1 63183652 unclassified probably null
R2166:Gpr1 UTSW 1 63183948 missense probably benign
R2895:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R2896:Gpr1 UTSW 1 63183162 missense probably benign 0.24
R5102:Gpr1 UTSW 1 63183167 missense probably damaging 0.99
R5131:Gpr1 UTSW 1 63183681 missense probably damaging 1.00
R5652:Gpr1 UTSW 1 63183467 missense probably benign 0.00
R6187:Gpr1 UTSW 1 63183275 missense probably damaging 1.00
X0060:Gpr1 UTSW 1 63183059 missense probably benign 0.02
Z1177:Gpr1 UTSW 1 63183639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGCTGATCACTGTCAAG -3'
(R):5'- AAGATCATCATGGAAGTCTCAAAGG -3'

Sequencing Primer
(F):5'- CTGGAAAACATGTTCAGTTGGGC -3'
(R):5'- TCATCATGGAAGTCTCAAAGGAAATG -3'
Posted On2016-10-06