Incidental Mutation 'R5471:Fam20b'
ID433790
Institutional Source Beutler Lab
Gene Symbol Fam20b
Ensembl Gene ENSMUSG00000033557
Gene Namefamily with sequence similarity 20, member B
SynonymsC530043G21Rik
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156678532-156719086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 156705729 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 106 (T106A)
Ref Sequence ENSEMBL: ENSMUSP00000112534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086153] [ENSMUST00000122424]
Predicted Effect probably damaging
Transcript: ENSMUST00000086153
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083322
Gene: ENSMUSG00000033557
AA Change: T106A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:Fam20C 188 399 3.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122424
AA Change: T106A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112534
Gene: ENSMUSG00000033557
AA Change: T106A

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:DUF1193 187 402 2e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188941
Meta Mutation Damage Score 0.3797 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with decreased embryo size, multisystem organ hypoplasia, and delayed skeleton, digestive system, eye, liver, and lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Fam20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Fam20b APN 1 156702465 missense probably benign 0.13
consequences UTSW 1 156690553 missense probably damaging 1.00
Head_over_heels UTSW 1 156690570 missense probably damaging 1.00
minuscule UTSW 1 156705740 missense probably damaging 1.00
squirt UTSW 1 156705729 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0389:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0443:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0518:Fam20b UTSW 1 156687456 missense possibly damaging 0.70
R1466:Fam20b UTSW 1 156686188 splice site probably benign
R1584:Fam20b UTSW 1 156686188 splice site probably benign
R2014:Fam20b UTSW 1 156705941 missense possibly damaging 0.92
R4085:Fam20b UTSW 1 156705875 missense probably benign 0.01
R4755:Fam20b UTSW 1 156687496 nonsense probably null
R5254:Fam20b UTSW 1 156705740 missense probably damaging 1.00
R6886:Fam20b UTSW 1 156690511 missense probably damaging 1.00
R6944:Fam20b UTSW 1 156687521 missense probably benign 0.02
R7013:Fam20b UTSW 1 156690565 missense probably damaging 1.00
R7205:Fam20b UTSW 1 156702398 critical splice donor site probably null
R7215:Fam20b UTSW 1 156690553 missense probably damaging 1.00
R7286:Fam20b UTSW 1 156681442 missense probably benign 0.28
R7684:Fam20b UTSW 1 156690645 missense probably benign 0.18
R8036:Fam20b UTSW 1 156705837 missense probably damaging 1.00
R8119:Fam20b UTSW 1 156690502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAGACCGGGTCCCATAG -3'
(R):5'- GAATGATGACTGGCTTGCG -3'

Sequencing Primer
(F):5'- AGAGACTTTTGAGATGTCCCAGCC -3'
(R):5'- ACTGGCTTGCGGGTGGAG -3'
Posted On2016-10-06