Incidental Mutation 'R5471:Vsx1'
ID 433793
Institutional Source Beutler Lab
Gene Symbol Vsx1
Ensembl Gene ENSMUSG00000033080
Gene Name visual system homeobox 1
Synonyms CHX10-like
MMRRC Submission 043032-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R5471 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 150522622-150531057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150524986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 343 (T343A)
Ref Sequence ENSEMBL: ENSMUSP00000039088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046095]
AlphaFold Q91V10
Predicted Effect probably benign
Transcript: ENSMUST00000046095
AA Change: T343A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039088
Gene: ENSMUSG00000033080
AA Change: T343A

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 99 116 N/A INTRINSIC
HOX 171 233 1.63e-26 SMART
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this locus impairs cone bipolar cell differentiation and affects retinal electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,259,829 (GRCm39) H493Y probably damaging Het
Alox12e T C 11: 70,210,850 (GRCm39) I290V probably benign Het
Ankfy1 T A 11: 72,619,617 (GRCm39) N163K probably benign Het
Baiap2l1 T G 5: 144,218,951 (GRCm39) N219T probably benign Het
Cd72 T C 4: 43,448,345 (GRCm39) I312V probably benign Het
Cfap54 A T 10: 92,864,522 (GRCm39) M139K probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Cmklr2 A C 1: 63,223,058 (GRCm39) V59G probably damaging Het
Cwh43 T A 5: 73,565,574 (GRCm39) C46* probably null Het
Cyp1a2 A T 9: 57,586,303 (GRCm39) I405N probably damaging Het
Dlc1 G T 8: 37,051,879 (GRCm39) S617R probably benign Het
Eif2ak4 A G 2: 118,304,613 (GRCm39) N1546S probably benign Het
Elmo1 A G 13: 20,756,555 (GRCm39) I548V probably benign Het
Exoc6 A G 19: 37,588,065 (GRCm39) D566G probably benign Het
Fam20b T C 1: 156,533,299 (GRCm39) T106A probably damaging Het
Fam83h T C 15: 75,874,752 (GRCm39) T862A probably benign Het
Fgfr1op2 A T 6: 146,498,860 (GRCm39) probably null Het
Gcnt2 A G 13: 41,014,195 (GRCm39) Y122C probably damaging Het
Gm11992 A T 11: 9,018,333 (GRCm39) probably null Het
Gm5114 C A 7: 39,058,534 (GRCm39) E362* probably null Het
Gm815 A G 19: 26,865,769 (GRCm39) T96A unknown Het
Gm8674 A G 13: 50,054,849 (GRCm39) noncoding transcript Het
Gnat3 T A 5: 18,196,322 (GRCm39) I56N probably damaging Het
Igkv1-133 T C 6: 67,702,531 (GRCm39) V83A probably benign Het
Mrgprb8 T A 7: 48,038,471 (GRCm39) N47K probably damaging Het
Nav2 A G 7: 49,197,917 (GRCm39) D1182G probably damaging Het
Neto2 T C 8: 86,367,389 (GRCm39) T480A probably benign Het
Npnt T G 3: 132,620,148 (GRCm39) N115T probably benign Het
Nr1h5 T C 3: 102,856,442 (GRCm39) N279S possibly damaging Het
Ntrk2 T C 13: 59,019,574 (GRCm39) V395A probably benign Het
Or2ak6 T C 11: 58,593,151 (GRCm39) L208S probably damaging Het
Or5ac23 T G 16: 59,148,994 (GRCm39) N293H probably damaging Het
Or6c1 A G 10: 129,517,925 (GRCm39) S228P probably damaging Het
Padi2 A G 4: 140,660,519 (GRCm39) K333R possibly damaging Het
Pira1 T A 7: 3,738,514 (GRCm39) I621F probably benign Het
Ptgis C A 2: 167,066,039 (GRCm39) M130I probably benign Het
Ptpn4 A T 1: 119,693,649 (GRCm39) Y124* probably null Het
Saal1 C T 7: 46,349,072 (GRCm39) V281M probably benign Het
Saxo1 G A 4: 86,363,961 (GRCm39) T174I probably damaging Het
Slc7a12 G A 3: 14,545,935 (GRCm39) V27M probably damaging Het
Slco4c1 C A 1: 96,799,770 (GRCm39) R22L probably benign Het
Slfn9 T G 11: 82,873,613 (GRCm39) Q430P possibly damaging Het
Slit2 T A 5: 48,346,897 (GRCm39) N246K probably damaging Het
Stox2 G T 8: 47,646,548 (GRCm39) T304K probably damaging Het
Tmem87b T G 2: 128,693,240 (GRCm39) F542V possibly damaging Het
Topaz1 T G 9: 122,620,481 (GRCm39) probably null Het
Trappc12 G A 12: 28,741,499 (GRCm39) R737W probably damaging Het
Trim9 A G 12: 70,393,566 (GRCm39) I126T possibly damaging Het
Txnl1 A G 18: 63,809,997 (GRCm39) C149R probably damaging Het
Ubald1 G A 16: 4,693,705 (GRCm39) T70M probably damaging Het
Vash1 G A 12: 86,735,902 (GRCm39) V263M possibly damaging Het
Zfp397 A G 18: 24,093,081 (GRCm39) N189D probably benign Het
Other mutations in Vsx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vsx1 APN 2 150,530,447 (GRCm39) missense probably benign
IGL02216:Vsx1 APN 2 150,526,495 (GRCm39) missense possibly damaging 0.95
IGL03089:Vsx1 APN 2 150,527,510 (GRCm39) splice site probably benign
R1725:Vsx1 UTSW 2 150,528,120 (GRCm39) missense probably benign 0.41
R4619:Vsx1 UTSW 2 150,530,529 (GRCm39) missense probably benign
R5956:Vsx1 UTSW 2 150,530,457 (GRCm39) missense possibly damaging 0.61
R6499:Vsx1 UTSW 2 150,530,441 (GRCm39) missense probably benign 0.13
Z1177:Vsx1 UTSW 2 150,530,662 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTATGAATGTTCCCCACTCTAG -3'
(R):5'- TCCACAGGGATGAGAAAACC -3'

Sequencing Primer
(F):5'- TGTTCCCCACTCTAGAACTAAAGGG -3'
(R):5'- CCAGAAAGTGAAGACAAGTTGGC -3'
Posted On 2016-10-06