Incidental Mutation 'R5471:Npnt'
ID433797
Institutional Source Beutler Lab
Gene Symbol Npnt
Ensembl Gene ENSMUSG00000040998
Gene Namenephronectin
Synonyms1110009H02Rik, POEM
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location132881745-132950291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132914387 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 115 (N115T)
Ref Sequence ENSEMBL: ENSMUSP00000113419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042729] [ENSMUST00000042744] [ENSMUST00000093971] [ENSMUST00000117164] [ENSMUST00000117456] [ENSMUST00000117811]
Predicted Effect probably benign
Transcript: ENSMUST00000042729
SMART Domains Protein: ENSMUSP00000040071
Gene: ENSMUSG00000040998

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 106 145 1.85e-9 SMART
EGF 149 185 1.73e1 SMART
EGF 189 230 7.53e-1 SMART
EGF_CA 231 271 5.31e-10 SMART
low complexity region 324 383 N/A INTRINSIC
Pfam:MAM 439 578 8.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042744
SMART Domains Protein: ENSMUSP00000040684
Gene: ENSMUSG00000040998

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 7.6e-4 SMART
EGF_CA 89 128 9e-12 SMART
EGF 132 168 8.5e-2 SMART
EGF 172 213 3.5e-3 SMART
EGF_CA 214 254 2.6e-12 SMART
low complexity region 307 366 N/A INTRINSIC
MAM 417 560 1.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093971
AA Change: N132T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091505
Gene: ENSMUSG00000040998
AA Change: N132T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 76 104 1.53e-1 SMART
EGF_CA 137 176 1.85e-9 SMART
EGF 180 216 1.73e1 SMART
EGF 220 261 7.53e-1 SMART
EGF_CA 262 302 5.31e-10 SMART
low complexity region 355 414 N/A INTRINSIC
Pfam:MAM 470 609 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117164
AA Change: N115T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113419
Gene: ENSMUSG00000040998
AA Change: N115T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 120 159 1.85e-9 SMART
EGF 163 199 1.73e1 SMART
EGF 203 244 7.53e-1 SMART
EGF_CA 245 285 5.31e-10 SMART
low complexity region 338 397 N/A INTRINSIC
Pfam:MAM 453 592 8.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117456
SMART Domains Protein: ENSMUSP00000112816
Gene: ENSMUSG00000040998

DomainStartEndE-ValueType
EGF 28 64 1.73e1 SMART
EGF 68 109 7.53e-1 SMART
EGF_CA 110 150 5.31e-10 SMART
low complexity region 203 262 N/A INTRINSIC
Pfam:MAM 318 457 5.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117811
SMART Domains Protein: ENSMUSP00000113752
Gene: ENSMUSG00000040998

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EGF 59 87 1.53e-1 SMART
EGF_CA 89 128 1.85e-9 SMART
EGF 132 168 1.73e1 SMART
EGF 172 213 7.53e-1 SMART
EGF_CA 214 254 5.31e-10 SMART
low complexity region 307 366 N/A INTRINSIC
Pfam:MAM 393 532 3.3e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele frequently exhibit kidney agenesis or hypoplasia attributed to a delay in the invasion of the metanephric mesenchyme by the ureteric bud at an early stage of kidney development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Npnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Npnt APN 3 132904657 critical splice donor site probably null
IGL01457:Npnt APN 3 132885982 missense probably damaging 1.00
IGL01954:Npnt APN 3 132909963 missense probably damaging 1.00
IGL01999:Npnt APN 3 132908399 missense probably damaging 1.00
IGL02012:Npnt APN 3 132908397 missense probably damaging 1.00
IGL02025:Npnt APN 3 132890762 critical splice donor site probably null
IGL02637:Npnt APN 3 132884510 missense possibly damaging 0.90
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R0234:Npnt UTSW 3 132914414 missense possibly damaging 0.82
R1680:Npnt UTSW 3 132906802 missense probably benign 0.00
R1729:Npnt UTSW 3 132914397 nonsense probably null
R1773:Npnt UTSW 3 132904693 missense possibly damaging 0.62
R1980:Npnt UTSW 3 132948132 missense probably benign 0.04
R1982:Npnt UTSW 3 132948132 missense probably benign 0.04
R2338:Npnt UTSW 3 132891409 missense probably damaging 1.00
R3800:Npnt UTSW 3 132906763 missense probably damaging 1.00
R4739:Npnt UTSW 3 132904691 missense possibly damaging 0.93
R4790:Npnt UTSW 3 132890762 critical splice donor site probably benign
R5008:Npnt UTSW 3 132906457 missense probably damaging 1.00
R5446:Npnt UTSW 3 132908369 missense probably damaging 1.00
R5538:Npnt UTSW 3 132904963 missense probably damaging 1.00
R5673:Npnt UTSW 3 132917497 missense probably damaging 0.97
R5683:Npnt UTSW 3 132906840 splice site probably null
R5827:Npnt UTSW 3 132906775 missense possibly damaging 0.89
R5857:Npnt UTSW 3 132908349 missense probably damaging 1.00
R5910:Npnt UTSW 3 132906418 missense probably damaging 1.00
R6208:Npnt UTSW 3 132950013 unclassified probably benign
R6358:Npnt UTSW 3 132904718 missense probably benign 0.18
R6875:Npnt UTSW 3 132909910 missense probably damaging 1.00
R7025:Npnt UTSW 3 132908396 missense probably damaging 1.00
R7145:Npnt UTSW 3 132909931 missense probably benign 0.01
R7166:Npnt UTSW 3 132948128 missense probably damaging 1.00
R7287:Npnt UTSW 3 132906802 missense probably benign 0.00
R7344:Npnt UTSW 3 132908339 splice site probably null
R8344:Npnt UTSW 3 132908456 missense probably damaging 1.00
R8717:Npnt UTSW 3 132908375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCCAGGGCACAGAGAATC -3'
(R):5'- TATTTGTGAAGTAGCCAGAGAGCC -3'

Sequencing Primer
(F):5'- TCAGCAGCAGGTGACAACTC -3'
(R):5'- GTAGCCAGAGAGCCCTATTAAGC -3'
Posted On2016-10-06