Incidental Mutation 'R5471:Baiap2l1'
ID433804
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene NameBAI1-associated protein 2-like 1
SynonymsIRTKS, 1300006M19Rik
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144264526-144358112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 144282141 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 219 (N219T)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
PDB Structure Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055190
AA Change: N219T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: N219T

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129287
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198873
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144285546 nonsense probably null
IGL00789:Baiap2l1 APN 5 144286069 splice site probably null
IGL00922:Baiap2l1 APN 5 144318967 missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144275913 missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144280815 intron probably benign
IGL02748:Baiap2l1 APN 5 144266605 intron probably benign
IGL03348:Baiap2l1 APN 5 144278531 missense probably benign 0.08
PIT4382001:Baiap2l1 UTSW 5 144278670 missense possibly damaging 0.71
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144266010 missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144266641 missense probably benign 0.21
R0755:Baiap2l1 UTSW 5 144284557 missense probably damaging 0.97
R0765:Baiap2l1 UTSW 5 144277703 missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144286133 missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144324555 critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144278535 missense possibly damaging 0.67
R4451:Baiap2l1 UTSW 5 144278552 missense probably damaging 1.00
R5093:Baiap2l1 UTSW 5 144278553 missense probably damaging 1.00
R5523:Baiap2l1 UTSW 5 144275958 missense probably damaging 1.00
R5524:Baiap2l1 UTSW 5 144280949 missense probably benign 0.01
R5586:Baiap2l1 UTSW 5 144282139 missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144265977 missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6353:Baiap2l1 UTSW 5 144282088 missense possibly damaging 0.80
R6572:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144286106 missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144285579 missense possibly damaging 0.94
R7218:Baiap2l1 UTSW 5 144275877 missense probably benign 0.01
R7352:Baiap2l1 UTSW 5 144324626 missense probably benign 0.03
R7662:Baiap2l1 UTSW 5 144357890 intron probably benign
R7797:Baiap2l1 UTSW 5 144318950 missense probably damaging 1.00
R7981:Baiap2l1 UTSW 5 144357890 intron probably benign
R8170:Baiap2l1 UTSW 5 144277692 nonsense probably null
R8308:Baiap2l1 UTSW 5 144277677 missense probably benign 0.06
R8333:Baiap2l1 UTSW 5 144280881 missense possibly damaging 0.89
R8673:Baiap2l1 UTSW 5 144276042 intron probably benign
X0022:Baiap2l1 UTSW 5 144278652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGGGTCAGTTTGAACTAATGC -3'
(R):5'- TGCCTCTTCAGCAACTGAGAC -3'

Sequencing Primer
(F):5'- GGTCAGTTTGAACTAATGCATACTAG -3'
(R):5'- GACACAGGAGATATTCATAGTTGC -3'
Posted On2016-10-06