Incidental Mutation 'R5471:Clec4n'
ID433806
Institutional Source Beutler Lab
Gene Symbol Clec4n
Ensembl Gene ENSMUSG00000023349
Gene NameC-type lectin domain family 4, member n
Synonymsdectin-2, Clecsf10, Nkcl
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123229843-123247021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123232186 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 70 (M70K)
Ref Sequence ENSEMBL: ENSMUSP00000145023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024118] [ENSMUST00000112554] [ENSMUST00000117130] [ENSMUST00000151714] [ENSMUST00000205129]
Predicted Effect probably benign
Transcript: ENSMUST00000024118
AA Change: M70K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024118
Gene: ENSMUSG00000023349
AA Change: M70K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 203 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112554
SMART Domains Protein: ENSMUSP00000108173
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 169 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117130
AA Change: M40K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113733
Gene: ENSMUSG00000023349
AA Change: M40K

DomainStartEndE-ValueType
CLECT 49 173 5.89e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144840
Predicted Effect probably benign
Transcript: ENSMUST00000151714
SMART Domains Protein: ENSMUSP00000120043
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205129
AA Change: M70K

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145023
Gene: ENSMUSG00000023349
AA Change: M70K

DomainStartEndE-ValueType
Blast:CLECT 26 72 3e-13 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele have defective responses to Candida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Clec4n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Clec4n APN 6 123244474 intron probably benign
IGL02248:Clec4n APN 6 123230568 missense probably damaging 0.99
IGL03181:Clec4n APN 6 123230515 missense possibly damaging 0.90
IGL03293:Clec4n APN 6 123232146 missense probably benign 0.10
P4717OSA:Clec4n UTSW 6 123244540 missense probably damaging 0.97
P4748:Clec4n UTSW 6 123244540 missense probably damaging 0.97
R1137:Clec4n UTSW 6 123246567 missense possibly damaging 0.80
R1445:Clec4n UTSW 6 123235516 missense probably benign 0.01
R1538:Clec4n UTSW 6 123230033 missense possibly damaging 0.66
R1804:Clec4n UTSW 6 123230022 missense possibly damaging 0.46
R1960:Clec4n UTSW 6 123230546 missense probably damaging 0.99
R2046:Clec4n UTSW 6 123246504 missense probably benign 0.00
R4097:Clec4n UTSW 6 123230741 missense possibly damaging 0.66
R4657:Clec4n UTSW 6 123232196 critical splice donor site probably null
R4967:Clec4n UTSW 6 123232107 missense probably benign 0.41
R6703:Clec4n UTSW 6 123235594 missense probably null 1.00
R7411:Clec4n UTSW 6 123232186 missense probably benign 0.06
R7877:Clec4n UTSW 6 123232104 missense probably benign 0.02
R7960:Clec4n UTSW 6 123232104 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGAGCAATAATTTAGTCTTGTCG -3'
(R):5'- AGAATGCTTGATAGTTTCCAAGTCG -3'

Sequencing Primer
(F):5'- GCAATAATTTAGTCTTGTCGTTAGTG -3'
(R):5'- TCCAAGTCGAAACATCTCTCTC -3'
Posted On2016-10-06