Incidental Mutation 'R5471:Gm5114'
ID433810
Institutional Source Beutler Lab
Gene Symbol Gm5114
Ensembl Gene ENSMUSG00000053742
Gene Namepredicted gene 5114
Synonyms
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location39407294-39413160 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 39409110 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 362 (E362*)
Ref Sequence ENSEMBL: ENSMUSP00000103652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108017]
Predicted Effect probably null
Transcript: ENSMUST00000108017
AA Change: E362*
SMART Domains Protein: ENSMUSP00000103652
Gene: ENSMUSG00000053742
AA Change: E362*

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 2.5e-65 PFAM
low complexity region 709 726 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Gm5114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Gm5114 APN 7 39410647 splice site probably benign
IGL01295:Gm5114 APN 7 39407817 missense probably damaging 1.00
IGL01349:Gm5114 APN 7 39409107 missense probably benign
IGL01633:Gm5114 APN 7 39408066 missense probably benign
IGL01634:Gm5114 APN 7 39408647 missense probably benign
IGL02072:Gm5114 APN 7 39411402 missense probably benign 0.00
FR4304:Gm5114 UTSW 7 39411105 missense probably benign
FR4304:Gm5114 UTSW 7 39411106 missense probably benign 0.00
R0034:Gm5114 UTSW 7 39408858 missense possibly damaging 0.83
R0127:Gm5114 UTSW 7 39408456 missense probably benign 0.00
R0328:Gm5114 UTSW 7 39408461 missense probably damaging 1.00
R0387:Gm5114 UTSW 7 39408809 missense probably benign 0.15
R0693:Gm5114 UTSW 7 39408764 missense probably benign 0.00
R1006:Gm5114 UTSW 7 39409086 missense probably damaging 1.00
R2039:Gm5114 UTSW 7 39409188 missense probably damaging 1.00
R3433:Gm5114 UTSW 7 39409197 missense probably benign 0.02
R3834:Gm5114 UTSW 7 39408737 missense possibly damaging 0.69
R4320:Gm5114 UTSW 7 39407627 missense probably damaging 1.00
R5214:Gm5114 UTSW 7 39408368 missense probably benign 0.19
R5443:Gm5114 UTSW 7 39408865 missense probably benign 0.00
R5707:Gm5114 UTSW 7 39411276 missense probably benign 0.01
R6129:Gm5114 UTSW 7 39408600 missense possibly damaging 0.71
R6234:Gm5114 UTSW 7 39409344 missense probably benign 0.19
R6326:Gm5114 UTSW 7 39408155 missense probably benign
R6443:Gm5114 UTSW 7 39407717 missense possibly damaging 0.91
R6530:Gm5114 UTSW 7 39408090 missense probably damaging 1.00
R6743:Gm5114 UTSW 7 39408573 missense probably benign 0.42
R6770:Gm5114 UTSW 7 39408543 missense possibly damaging 0.94
R6885:Gm5114 UTSW 7 39408156 missense probably benign 0.01
R6980:Gm5114 UTSW 7 39409200 missense probably benign 0.01
R7100:Gm5114 UTSW 7 39408284 missense possibly damaging 0.52
R7215:Gm5114 UTSW 7 39411371 missense probably benign 0.02
R7254:Gm5114 UTSW 7 39408966 missense probably benign 0.35
R7343:Gm5114 UTSW 7 39408756 missense probably damaging 1.00
R7366:Gm5114 UTSW 7 39409344 missense possibly damaging 0.69
R7474:Gm5114 UTSW 7 39407980 missense probably benign 0.01
R7499:Gm5114 UTSW 7 39409065 missense possibly damaging 0.55
R8022:Gm5114 UTSW 7 39409376 missense probably benign
R8121:Gm5114 UTSW 7 39408128 missense probably benign 0.15
R8201:Gm5114 UTSW 7 39410949 missense probably damaging 0.98
R8212:Gm5114 UTSW 7 39411252 missense probably benign 0.18
R8321:Gm5114 UTSW 7 39410849 missense possibly damaging 0.85
R8725:Gm5114 UTSW 7 39411233 missense probably benign 0.17
R8752:Gm5114 UTSW 7 39408503 missense probably damaging 0.99
Z1088:Gm5114 UTSW 7 39408447 missense probably damaging 1.00
Z1177:Gm5114 UTSW 7 39409326 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGGACTGATCTTGGTCTATGTC -3'
(R):5'- TAAGGCCACCAGCTGTCAAC -3'

Sequencing Primer
(F):5'- ACTGATCTTGGTCTATGTCTGTGAG -3'
(R):5'- GGACAGGGCATTAACAGCCC -3'
Posted On2016-10-06