Incidental Mutation 'R5471:Dlc1'
ID 433817
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Name deleted in liver cancer 1
Synonyms p122-RhoGAP, Arhgap7, A730069N07Rik, STARD12
MMRRC Submission 043032-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5471 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 37034905-37420297 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 37051879 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 617 (S617R)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033923
AA Change: S166R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: S166R

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098826
AA Change: S200R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: S200R

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163663
AA Change: S617R

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: S617R

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,259,829 (GRCm39) H493Y probably damaging Het
Alox12e T C 11: 70,210,850 (GRCm39) I290V probably benign Het
Ankfy1 T A 11: 72,619,617 (GRCm39) N163K probably benign Het
Baiap2l1 T G 5: 144,218,951 (GRCm39) N219T probably benign Het
Cd72 T C 4: 43,448,345 (GRCm39) I312V probably benign Het
Cfap54 A T 10: 92,864,522 (GRCm39) M139K probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Cmklr2 A C 1: 63,223,058 (GRCm39) V59G probably damaging Het
Cwh43 T A 5: 73,565,574 (GRCm39) C46* probably null Het
Cyp1a2 A T 9: 57,586,303 (GRCm39) I405N probably damaging Het
Eif2ak4 A G 2: 118,304,613 (GRCm39) N1546S probably benign Het
Elmo1 A G 13: 20,756,555 (GRCm39) I548V probably benign Het
Exoc6 A G 19: 37,588,065 (GRCm39) D566G probably benign Het
Fam20b T C 1: 156,533,299 (GRCm39) T106A probably damaging Het
Fam83h T C 15: 75,874,752 (GRCm39) T862A probably benign Het
Fgfr1op2 A T 6: 146,498,860 (GRCm39) probably null Het
Gcnt2 A G 13: 41,014,195 (GRCm39) Y122C probably damaging Het
Gm11992 A T 11: 9,018,333 (GRCm39) probably null Het
Gm5114 C A 7: 39,058,534 (GRCm39) E362* probably null Het
Gm815 A G 19: 26,865,769 (GRCm39) T96A unknown Het
Gm8674 A G 13: 50,054,849 (GRCm39) noncoding transcript Het
Gnat3 T A 5: 18,196,322 (GRCm39) I56N probably damaging Het
Igkv1-133 T C 6: 67,702,531 (GRCm39) V83A probably benign Het
Mrgprb8 T A 7: 48,038,471 (GRCm39) N47K probably damaging Het
Nav2 A G 7: 49,197,917 (GRCm39) D1182G probably damaging Het
Neto2 T C 8: 86,367,389 (GRCm39) T480A probably benign Het
Npnt T G 3: 132,620,148 (GRCm39) N115T probably benign Het
Nr1h5 T C 3: 102,856,442 (GRCm39) N279S possibly damaging Het
Ntrk2 T C 13: 59,019,574 (GRCm39) V395A probably benign Het
Or2ak6 T C 11: 58,593,151 (GRCm39) L208S probably damaging Het
Or5ac23 T G 16: 59,148,994 (GRCm39) N293H probably damaging Het
Or6c1 A G 10: 129,517,925 (GRCm39) S228P probably damaging Het
Padi2 A G 4: 140,660,519 (GRCm39) K333R possibly damaging Het
Pira1 T A 7: 3,738,514 (GRCm39) I621F probably benign Het
Ptgis C A 2: 167,066,039 (GRCm39) M130I probably benign Het
Ptpn4 A T 1: 119,693,649 (GRCm39) Y124* probably null Het
Saal1 C T 7: 46,349,072 (GRCm39) V281M probably benign Het
Saxo1 G A 4: 86,363,961 (GRCm39) T174I probably damaging Het
Slc7a12 G A 3: 14,545,935 (GRCm39) V27M probably damaging Het
Slco4c1 C A 1: 96,799,770 (GRCm39) R22L probably benign Het
Slfn9 T G 11: 82,873,613 (GRCm39) Q430P possibly damaging Het
Slit2 T A 5: 48,346,897 (GRCm39) N246K probably damaging Het
Stox2 G T 8: 47,646,548 (GRCm39) T304K probably damaging Het
Tmem87b T G 2: 128,693,240 (GRCm39) F542V possibly damaging Het
Topaz1 T G 9: 122,620,481 (GRCm39) probably null Het
Trappc12 G A 12: 28,741,499 (GRCm39) R737W probably damaging Het
Trim9 A G 12: 70,393,566 (GRCm39) I126T possibly damaging Het
Txnl1 A G 18: 63,809,997 (GRCm39) C149R probably damaging Het
Ubald1 G A 16: 4,693,705 (GRCm39) T70M probably damaging Het
Vash1 G A 12: 86,735,902 (GRCm39) V263M possibly damaging Het
Vsx1 T C 2: 150,524,986 (GRCm39) T343A probably benign Het
Zfp397 A G 18: 24,093,081 (GRCm39) N189D probably benign Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 37,037,436 (GRCm39) utr 3 prime probably benign
IGL00807:Dlc1 APN 8 37,040,002 (GRCm39) missense probably benign 0.01
IGL00924:Dlc1 APN 8 37,405,368 (GRCm39) missense probably benign
IGL01349:Dlc1 APN 8 37,050,978 (GRCm39) missense probably damaging 0.96
IGL01419:Dlc1 APN 8 37,317,371 (GRCm39) missense probably benign 0.02
IGL01871:Dlc1 APN 8 37,317,334 (GRCm39) missense probably damaging 0.99
IGL01937:Dlc1 APN 8 37,317,345 (GRCm39) missense probably benign 0.25
IGL02525:Dlc1 APN 8 37,046,800 (GRCm39) missense probably damaging 1.00
IGL02696:Dlc1 APN 8 37,041,326 (GRCm39) missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 37,037,429 (GRCm39) utr 3 prime probably benign
IGL03029:Dlc1 APN 8 37,038,416 (GRCm39) splice site probably null
BB001:Dlc1 UTSW 8 37,038,570 (GRCm39) missense probably benign 0.03
BB011:Dlc1 UTSW 8 37,038,570 (GRCm39) missense probably benign 0.03
IGL02835:Dlc1 UTSW 8 37,051,055 (GRCm39) missense probably damaging 1.00
R0068:Dlc1 UTSW 8 37,404,875 (GRCm39) missense probably benign
R0068:Dlc1 UTSW 8 37,404,875 (GRCm39) missense probably benign
R0164:Dlc1 UTSW 8 37,066,594 (GRCm39) missense probably damaging 0.96
R0164:Dlc1 UTSW 8 37,066,594 (GRCm39) missense probably damaging 0.96
R0218:Dlc1 UTSW 8 37,317,383 (GRCm39) missense probably benign
R0419:Dlc1 UTSW 8 37,050,740 (GRCm39) missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 37,051,164 (GRCm39) missense probably damaging 1.00
R0645:Dlc1 UTSW 8 37,041,203 (GRCm39) missense possibly damaging 0.60
R0646:Dlc1 UTSW 8 37,325,205 (GRCm39) missense probably benign
R0727:Dlc1 UTSW 8 37,039,828 (GRCm39) missense probably damaging 0.99
R0792:Dlc1 UTSW 8 37,405,702 (GRCm39) missense probably benign 0.00
R1061:Dlc1 UTSW 8 37,325,205 (GRCm39) missense probably benign
R1221:Dlc1 UTSW 8 37,051,985 (GRCm39) missense probably benign
R1440:Dlc1 UTSW 8 37,060,617 (GRCm39) splice site probably benign
R1501:Dlc1 UTSW 8 37,405,302 (GRCm39) missense probably benign 0.06
R1606:Dlc1 UTSW 8 37,317,406 (GRCm39) missense probably benign
R1707:Dlc1 UTSW 8 37,404,763 (GRCm39) missense probably benign 0.03
R1750:Dlc1 UTSW 8 37,325,244 (GRCm39) splice site probably null
R1762:Dlc1 UTSW 8 37,404,739 (GRCm39) missense probably benign 0.25
R2041:Dlc1 UTSW 8 37,049,922 (GRCm39) missense probably damaging 1.00
R2055:Dlc1 UTSW 8 37,060,535 (GRCm39) missense probably damaging 0.98
R2091:Dlc1 UTSW 8 37,404,763 (GRCm39) missense probably benign 0.00
R2987:Dlc1 UTSW 8 37,041,306 (GRCm39) missense probably damaging 0.97
R4285:Dlc1 UTSW 8 37,041,282 (GRCm39) missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 37,051,907 (GRCm39) missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 37,404,712 (GRCm39) critical splice donor site probably null
R4828:Dlc1 UTSW 8 37,317,400 (GRCm39) missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 37,051,799 (GRCm39) missense probably benign 0.01
R4902:Dlc1 UTSW 8 37,044,285 (GRCm39) missense probably damaging 1.00
R5067:Dlc1 UTSW 8 37,051,647 (GRCm39) missense probably benign 0.04
R5068:Dlc1 UTSW 8 37,405,184 (GRCm39) missense probably benign
R5198:Dlc1 UTSW 8 37,405,552 (GRCm39) missense probably damaging 1.00
R5668:Dlc1 UTSW 8 37,404,655 (GRCm39) unclassified probably benign
R5915:Dlc1 UTSW 8 37,405,829 (GRCm39) utr 5 prime probably benign
R6323:Dlc1 UTSW 8 37,405,537 (GRCm39) missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 37,039,870 (GRCm39) missense probably damaging 1.00
R6908:Dlc1 UTSW 8 37,404,841 (GRCm39) missense probably benign 0.02
R6914:Dlc1 UTSW 8 37,405,364 (GRCm39) missense probably benign
R6942:Dlc1 UTSW 8 37,405,364 (GRCm39) missense probably benign
R7269:Dlc1 UTSW 8 37,046,407 (GRCm39) missense probably damaging 1.00
R7271:Dlc1 UTSW 8 37,049,954 (GRCm39) missense probably damaging 0.99
R7462:Dlc1 UTSW 8 37,405,118 (GRCm39) missense unknown
R7548:Dlc1 UTSW 8 37,051,809 (GRCm39) missense probably benign 0.00
R7649:Dlc1 UTSW 8 37,049,894 (GRCm39) missense probably damaging 1.00
R7924:Dlc1 UTSW 8 37,038,570 (GRCm39) missense probably benign 0.03
R7960:Dlc1 UTSW 8 37,404,989 (GRCm39) missense probably benign
R7984:Dlc1 UTSW 8 37,405,472 (GRCm39) missense possibly damaging 0.85
R8227:Dlc1 UTSW 8 37,039,825 (GRCm39) missense probably damaging 1.00
R8491:Dlc1 UTSW 8 37,052,000 (GRCm39) missense probably benign
R8526:Dlc1 UTSW 8 37,404,968 (GRCm39) missense probably benign 0.00
R8715:Dlc1 UTSW 8 37,405,795 (GRCm39) start gained probably benign
R8887:Dlc1 UTSW 8 37,051,481 (GRCm39) missense probably benign 0.34
R8972:Dlc1 UTSW 8 37,405,394 (GRCm39) nonsense probably null
R8988:Dlc1 UTSW 8 37,039,997 (GRCm39) missense probably damaging 0.96
R9031:Dlc1 UTSW 8 37,405,055 (GRCm39) missense possibly damaging 0.95
R9080:Dlc1 UTSW 8 37,052,006 (GRCm39) missense probably benign
R9092:Dlc1 UTSW 8 37,199,860 (GRCm39) missense probably benign 0.03
R9096:Dlc1 UTSW 8 37,080,721 (GRCm39) missense probably benign 0.00
R9097:Dlc1 UTSW 8 37,080,721 (GRCm39) missense probably benign 0.00
R9166:Dlc1 UTSW 8 37,066,589 (GRCm39) missense probably damaging 1.00
R9187:Dlc1 UTSW 8 37,405,786 (GRCm39) start codon destroyed probably null 1.00
R9240:Dlc1 UTSW 8 37,052,005 (GRCm39) missense probably benign
R9276:Dlc1 UTSW 8 37,046,558 (GRCm39) missense possibly damaging 0.83
R9325:Dlc1 UTSW 8 37,038,518 (GRCm39) missense possibly damaging 0.83
Z1176:Dlc1 UTSW 8 37,051,365 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTCTCCATGCGTTTG -3'
(R):5'- GACTTTCCAGAGGGACAGCAAG -3'

Sequencing Primer
(F):5'- TGCGTTTGAGCAGGCTCC -3'
(R):5'- GACAGCAAGCGGTGGTC -3'
Posted On 2016-10-06