Incidental Mutation 'R5471:Neto2'
ID 433819
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 043032-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R5471 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86367389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 480 (T480A)
Ref Sequence ENSEMBL: ENSMUSP00000105308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably benign
Transcript: ENSMUST00000109686
AA Change: T480A

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: T480A

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably benign
Transcript: ENSMUST00000209479
AA Change: T445A

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably benign
Transcript: ENSMUST00000216286
AA Change: T452A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0705 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,259,829 (GRCm39) H493Y probably damaging Het
Alox12e T C 11: 70,210,850 (GRCm39) I290V probably benign Het
Ankfy1 T A 11: 72,619,617 (GRCm39) N163K probably benign Het
Baiap2l1 T G 5: 144,218,951 (GRCm39) N219T probably benign Het
Cd72 T C 4: 43,448,345 (GRCm39) I312V probably benign Het
Cfap54 A T 10: 92,864,522 (GRCm39) M139K probably damaging Het
Clec4n T A 6: 123,209,145 (GRCm39) M70K probably benign Het
Cmklr2 A C 1: 63,223,058 (GRCm39) V59G probably damaging Het
Cwh43 T A 5: 73,565,574 (GRCm39) C46* probably null Het
Cyp1a2 A T 9: 57,586,303 (GRCm39) I405N probably damaging Het
Dlc1 G T 8: 37,051,879 (GRCm39) S617R probably benign Het
Eif2ak4 A G 2: 118,304,613 (GRCm39) N1546S probably benign Het
Elmo1 A G 13: 20,756,555 (GRCm39) I548V probably benign Het
Exoc6 A G 19: 37,588,065 (GRCm39) D566G probably benign Het
Fam20b T C 1: 156,533,299 (GRCm39) T106A probably damaging Het
Fam83h T C 15: 75,874,752 (GRCm39) T862A probably benign Het
Fgfr1op2 A T 6: 146,498,860 (GRCm39) probably null Het
Gcnt2 A G 13: 41,014,195 (GRCm39) Y122C probably damaging Het
Gm11992 A T 11: 9,018,333 (GRCm39) probably null Het
Gm5114 C A 7: 39,058,534 (GRCm39) E362* probably null Het
Gm815 A G 19: 26,865,769 (GRCm39) T96A unknown Het
Gm8674 A G 13: 50,054,849 (GRCm39) noncoding transcript Het
Gnat3 T A 5: 18,196,322 (GRCm39) I56N probably damaging Het
Igkv1-133 T C 6: 67,702,531 (GRCm39) V83A probably benign Het
Mrgprb8 T A 7: 48,038,471 (GRCm39) N47K probably damaging Het
Nav2 A G 7: 49,197,917 (GRCm39) D1182G probably damaging Het
Npnt T G 3: 132,620,148 (GRCm39) N115T probably benign Het
Nr1h5 T C 3: 102,856,442 (GRCm39) N279S possibly damaging Het
Ntrk2 T C 13: 59,019,574 (GRCm39) V395A probably benign Het
Or2ak6 T C 11: 58,593,151 (GRCm39) L208S probably damaging Het
Or5ac23 T G 16: 59,148,994 (GRCm39) N293H probably damaging Het
Or6c1 A G 10: 129,517,925 (GRCm39) S228P probably damaging Het
Padi2 A G 4: 140,660,519 (GRCm39) K333R possibly damaging Het
Pira1 T A 7: 3,738,514 (GRCm39) I621F probably benign Het
Ptgis C A 2: 167,066,039 (GRCm39) M130I probably benign Het
Ptpn4 A T 1: 119,693,649 (GRCm39) Y124* probably null Het
Saal1 C T 7: 46,349,072 (GRCm39) V281M probably benign Het
Saxo1 G A 4: 86,363,961 (GRCm39) T174I probably damaging Het
Slc7a12 G A 3: 14,545,935 (GRCm39) V27M probably damaging Het
Slco4c1 C A 1: 96,799,770 (GRCm39) R22L probably benign Het
Slfn9 T G 11: 82,873,613 (GRCm39) Q430P possibly damaging Het
Slit2 T A 5: 48,346,897 (GRCm39) N246K probably damaging Het
Stox2 G T 8: 47,646,548 (GRCm39) T304K probably damaging Het
Tmem87b T G 2: 128,693,240 (GRCm39) F542V possibly damaging Het
Topaz1 T G 9: 122,620,481 (GRCm39) probably null Het
Trappc12 G A 12: 28,741,499 (GRCm39) R737W probably damaging Het
Trim9 A G 12: 70,393,566 (GRCm39) I126T possibly damaging Het
Txnl1 A G 18: 63,809,997 (GRCm39) C149R probably damaging Het
Ubald1 G A 16: 4,693,705 (GRCm39) T70M probably damaging Het
Vash1 G A 12: 86,735,902 (GRCm39) V263M possibly damaging Het
Vsx1 T C 2: 150,524,986 (GRCm39) T343A probably benign Het
Zfp397 A G 18: 24,093,081 (GRCm39) N189D probably benign Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R5571:Neto2 UTSW 8 86,367,173 (GRCm39) missense probably damaging 1.00
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTCTGACATAAATTTCACAGG -3'
(R):5'- GGTTATGGCTTGCAAAACTGC -3'

Sequencing Primer
(F):5'- TAAATTTCACAGGGAATCTCCTCC -3'
(R):5'- GGTTCCAGGAAGTATTTGATCCTCC -3'
Posted On 2016-10-06