Incidental Mutation 'R0481:Rdh1'
ID 43382
Institutional Source Beutler Lab
Gene Symbol Rdh1
Ensembl Gene ENSMUSG00000089789
Gene Name retinol dehydrogenase 1 (all trans)
MMRRC Submission 038681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock # R0481 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 127759721-127768297 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 127763124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 158 (R158L)
Ref Sequence ENSEMBL: ENSMUSP00000073322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073639] [ENSMUST00000128247]
AlphaFold Q8CGV4
Predicted Effect probably damaging
Transcript: ENSMUST00000073639
AA Change: R158L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073322
Gene: ENSMUSG00000089789
AA Change: R158L

signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 222 5.7e-43 PFAM
Pfam:DUF1776 43 303 3.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128247
SMART Domains Protein: ENSMUSP00000116574
Gene: ENSMUSG00000099009

signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 195 1.7e-23 PFAM
Pfam:DUF1776 43 303 3.3e-8 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, adipose tissue, and retinol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdk13 C A 13: 17,719,494 A1123S probably damaging Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Rdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02745:Rdh1 APN 10 127765419 missense probably benign 0.06
R0077:Rdh1 UTSW 10 127760037 missense probably damaging 1.00
R0511:Rdh1 UTSW 10 127764783 missense probably benign
R0558:Rdh1 UTSW 10 127759941 missense possibly damaging 0.88
R1569:Rdh1 UTSW 10 127763072 missense probably benign
R1993:Rdh1 UTSW 10 127765345 missense probably benign
R2164:Rdh1 UTSW 10 127760172 missense possibly damaging 0.89
R3021:Rdh1 UTSW 10 127760208 missense possibly damaging 0.91
R5268:Rdh1 UTSW 10 127759963 missense possibly damaging 0.67
R6126:Rdh1 UTSW 10 127763214 missense probably damaging 1.00
R6216:Rdh1 UTSW 10 127764753 missense probably benign 0.00
R7017:Rdh1 UTSW 10 127763037 missense probably benign 0.02
R7332:Rdh1 UTSW 10 127759885 start gained probably benign
R7397:Rdh1 UTSW 10 127760178 missense probably benign 0.24
R7721:Rdh1 UTSW 10 127760252 critical splice donor site probably null
R7724:Rdh1 UTSW 10 127764707 missense possibly damaging 0.46
R7873:Rdh1 UTSW 10 127760023 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aggaaagcagctaattctctttac -3'
Posted On 2013-05-23