Incidental Mutation 'R5471:Cyp1a2'
ID433820
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 2
SynonymsCP12, aromatic compound inducible, P450-3
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57676937-57683703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57679020 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 405 (I405N)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
Predicted Effect probably damaging
Transcript: ENSMUST00000034860
AA Change: I405N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: I405N

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215792
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57682069 nonsense probably null
IGL01161:Cyp1a2 APN 9 57679893 missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57682372 missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57682202 missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57682395 missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57677228 makesense probably null
IGL03349:Cyp1a2 APN 9 57679875 missense possibly damaging 0.82
PIT4515001:Cyp1a2 UTSW 9 57681959 missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57682061 missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57682025 missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57680246 splice site probably benign
R0589:Cyp1a2 UTSW 9 57679062 missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57681767 missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57682286 missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57682150 missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57677515 missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57679949 missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57681868 missense probably benign
R5225:Cyp1a2 UTSW 9 57677233 nonsense probably null
R5419:Cyp1a2 UTSW 9 57682511 missense probably benign 0.17
R5816:Cyp1a2 UTSW 9 57681053 missense probably benign
R6017:Cyp1a2 UTSW 9 57681030 missense probably damaging 0.98
R6825:Cyp1a2 UTSW 9 57677260 missense probably benign 0.01
R6931:Cyp1a2 UTSW 9 57682156 missense probably benign 0.02
R7058:Cyp1a2 UTSW 9 57677242 missense probably damaging 0.99
R7079:Cyp1a2 UTSW 9 57681878 missense probably benign
R7081:Cyp1a2 UTSW 9 57678989 missense possibly damaging 0.52
R7400:Cyp1a2 UTSW 9 57681940 missense probably benign 0.37
R7672:Cyp1a2 UTSW 9 57682337 missense probably benign 0.05
RF007:Cyp1a2 UTSW 9 57681970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAACAGGGTCTAAGTTTTGTC -3'
(R):5'- AATGTCCAAGAGCAGGATCC -3'

Sequencing Primer
(F):5'- TGTCACTTAGAACAGACTATCTAGC -3'
(R):5'- GCAATTGCCCCATATTCCATGAC -3'
Posted On2016-10-06