Incidental Mutation 'R5471:Topaz1'
ID433821
Institutional Source Beutler Lab
Gene Symbol Topaz1
Ensembl Gene ENSMUSG00000094985
Gene Nametestis and ovary specific PAZ domain containing 1
SynonymsGm9524
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122747346-122802135 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 122791416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178679]
Predicted Effect probably null
Transcript: ENSMUST00000178679
SMART Domains Protein: ENSMUSP00000136304
Gene: ENSMUSG00000094985

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 27 39 N/A INTRINSIC
low complexity region 236 251 N/A INTRINSIC
low complexity region 531 545 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
low complexity region 1129 1139 N/A INTRINSIC
Pfam:Asp_Glu_race_2 1189 1422 3.6e-157 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with abnormal meiosis and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Topaz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0083:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0098:Topaz1 UTSW 9 122790123 missense possibly damaging 0.93
R0108:Topaz1 UTSW 9 122775609 missense probably benign 0.08
R0220:Topaz1 UTSW 9 122749303 missense possibly damaging 0.53
R0519:Topaz1 UTSW 9 122749479 missense possibly damaging 0.53
R0617:Topaz1 UTSW 9 122749906 missense possibly damaging 0.73
R0637:Topaz1 UTSW 9 122791477 nonsense probably null
R0637:Topaz1 UTSW 9 122797662 missense probably benign
R1368:Topaz1 UTSW 9 122748250 missense possibly damaging 0.72
R1519:Topaz1 UTSW 9 122767011 missense probably benign 0.33
R1526:Topaz1 UTSW 9 122796043 missense probably damaging 0.98
R1634:Topaz1 UTSW 9 122780675 splice site probably benign
R1871:Topaz1 UTSW 9 122799479 missense probably benign 0.18
R1879:Topaz1 UTSW 9 122749619 missense possibly damaging 0.70
R1913:Topaz1 UTSW 9 122767013 missense possibly damaging 0.73
R1977:Topaz1 UTSW 9 122747362 missense unknown
R1989:Topaz1 UTSW 9 122750125 missense possibly damaging 0.86
R2237:Topaz1 UTSW 9 122771147 missense probably benign
R2238:Topaz1 UTSW 9 122771147 missense probably benign
R2239:Topaz1 UTSW 9 122771147 missense probably benign
R3160:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3161:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3162:Topaz1 UTSW 9 122749381 missense probably benign 0.33
R3821:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3822:Topaz1 UTSW 9 122797783 missense possibly damaging 0.85
R3944:Topaz1 UTSW 9 122750604 missense possibly damaging 0.73
R4571:Topaz1 UTSW 9 122747436 missense probably benign 0.01
R4580:Topaz1 UTSW 9 122747515 missense probably null 0.00
R5043:Topaz1 UTSW 9 122748404 missense probably benign
R5084:Topaz1 UTSW 9 122748818 missense probably benign 0.04
R5234:Topaz1 UTSW 9 122790193 missense possibly damaging 0.82
R5388:Topaz1 UTSW 9 122774093 missense possibly damaging 0.96
R5706:Topaz1 UTSW 9 122799485 missense possibly damaging 0.53
R5993:Topaz1 UTSW 9 122749039 missense probably benign 0.00
R6104:Topaz1 UTSW 9 122749866 missense probably benign
R6137:Topaz1 UTSW 9 122797756 missense possibly damaging 0.53
R6186:Topaz1 UTSW 9 122748826 missense probably benign 0.33
R6209:Topaz1 UTSW 9 122750505 missense possibly damaging 0.85
R6543:Topaz1 UTSW 9 122748535 missense possibly damaging 0.53
R6548:Topaz1 UTSW 9 122748354 missense possibly damaging 0.53
R6557:Topaz1 UTSW 9 122748895 missense probably benign 0.02
R6636:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6637:Topaz1 UTSW 9 122749786 missense probably benign 0.33
R6859:Topaz1 UTSW 9 122801958 missense probably benign 0.33
R7123:Topaz1 UTSW 9 122748415 missense probably damaging 1.00
R7180:Topaz1 UTSW 9 122797705 missense possibly damaging 0.85
R7319:Topaz1 UTSW 9 122750363 missense possibly damaging 0.73
R7743:Topaz1 UTSW 9 122785136 missense probably benign 0.16
R7810:Topaz1 UTSW 9 122749185 missense probably benign 0.18
R7871:Topaz1 UTSW 9 122780700 missense possibly damaging 0.96
R7875:Topaz1 UTSW 9 122749587 missense possibly damaging 0.53
R7954:Topaz1 UTSW 9 122780700 missense possibly damaging 0.96
R7958:Topaz1 UTSW 9 122749587 missense possibly damaging 0.53
R8116:Topaz1 UTSW 9 122775643 missense probably benign 0.00
X0020:Topaz1 UTSW 9 122774069 missense possibly damaging 0.96
Z1176:Topaz1 UTSW 9 122791494 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCTGTAAACGGTCAGAGAGTAACTC -3'
(R):5'- AGGATGACTCCATGTCCTGTTCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CACAGCAACAGTCTGTGA -3'
Posted On2016-10-06