Incidental Mutation 'R5471:Olfr802'
ID433823
Institutional Source Beutler Lab
Gene Symbol Olfr802
Ensembl Gene ENSMUSG00000093866
Gene Nameolfactory receptor 802
SynonymsGA_x6K02T2PULF-11361362-11360424, MOR111-1
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129677683-129688169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129682056 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 228 (S228P)
Ref Sequence ENSEMBL: ENSMUSP00000150123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074713] [ENSMUST00000203785] [ENSMUST00000217576]
Predicted Effect probably damaging
Transcript: ENSMUST00000074713
AA Change: S228P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074275
Gene: ENSMUSG00000093866
AA Change: S228P

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203785
AA Change: S228P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866
AA Change: S228P

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217576
AA Change: S228P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.3062 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Olfr802
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Olfr802 APN 10 129681988 nonsense probably null
IGL03112:Olfr802 APN 10 129681923 missense probably benign 0.08
R0366:Olfr802 UTSW 10 129681971 missense possibly damaging 0.72
R0463:Olfr802 UTSW 10 129681839 missense probably benign 0.11
R0579:Olfr802 UTSW 10 129682237 nonsense probably null
R1769:Olfr802 UTSW 10 129682212 missense probably benign 0.15
R2128:Olfr802 UTSW 10 129682532 missense possibly damaging 0.78
R2375:Olfr802 UTSW 10 129682163 missense probably benign 0.04
R3888:Olfr802 UTSW 10 129682218 missense possibly damaging 0.94
R3888:Olfr802 UTSW 10 129682219 missense probably benign 0.43
R4956:Olfr802 UTSW 10 129682099 missense probably benign 0.00
R5588:Olfr802 UTSW 10 129681836 missense possibly damaging 0.72
R7305:Olfr802 UTSW 10 129682280 missense probably damaging 0.99
R7969:Olfr802 UTSW 10 129681830 missense probably benign
R7995:Olfr802 UTSW 10 129682640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGGCTTGCTTGACTTGCTG -3'
(R):5'- TTGTGGCTCCAATATCATTGATCAC -3'

Sequencing Primer
(F):5'- TTCCTCAGGCTATAAATGAAGGG -3'
(R):5'- GGCTCCAATATCATTGATCACTATAC -3'
Posted On2016-10-06