Incidental Mutation 'R5471:Ankfy1'
ID433827
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Nameankyrin repeat and FYVE domain containing 1
SynonymsAnkhzn
MMRRC Submission 043032-MU
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72690006-72772146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72728791 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 163 (N163K)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102548
Predicted Effect probably benign
Transcript: ENSMUST00000127610
AA Change: N163K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790
AA Change: N163K

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150172
Predicted Effect probably benign
Transcript: ENSMUST00000155998
AA Change: N163K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: N163K

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Meta Mutation Damage Score 0.1261 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7410:Ankfy1 UTSW 11 72761504 missense probably damaging 1.00
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAATGCATATGACCAGGTTTG -3'
(R):5'- GGATACTGTGGAAACAGGGTTTAC -3'

Sequencing Primer
(F):5'- GCAGTAGCCTAGCCATACTTC -3'
(R):5'- CAGGGTTTACACTGGGATCTCC -3'
Posted On2016-10-06