Incidental Mutation 'R5471:Trappc12'
ID433829
Institutional Source Beutler Lab
Gene Symbol Trappc12
Ensembl Gene ENSMUSG00000020628
Gene Nametrafficking protein particle complex 12
SynonymsTtc15, D930014A20Rik, CGI-87
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R5471 (G1)
Quality Score204
Status Validated
Chromosome12
Chromosomal Location28690628-28750472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28691500 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 737 (R737W)
Ref Sequence ENSEMBL: ENSMUSP00000127752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000168129]
Predicted Effect probably damaging
Transcript: ENSMUST00000020954
AA Change: R737W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: R737W

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168129
AA Change: R737W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: R737W

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Meta Mutation Damage Score 0.3838 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Trappc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trappc12 APN 12 28737836 missense probably damaging 0.99
IGL01018:Trappc12 APN 12 28691854 splice site probably benign
IGL01295:Trappc12 APN 12 28746762 missense probably damaging 1.00
IGL01365:Trappc12 APN 12 28747402 missense probably damaging 1.00
IGL01490:Trappc12 APN 12 28746915 missense probably damaging 1.00
IGL01975:Trappc12 APN 12 28692492 critical splice donor site probably null
IGL02851:Trappc12 APN 12 28691406 missense probably damaging 0.98
IGL02885:Trappc12 APN 12 28747014 missense probably benign
IGL03163:Trappc12 APN 12 28746654 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0330:Trappc12 UTSW 12 28747260 missense probably benign 0.00
R0517:Trappc12 UTSW 12 28697134 splice site probably benign
R0837:Trappc12 UTSW 12 28703597 missense possibly damaging 0.92
R1439:Trappc12 UTSW 12 28747161 missense possibly damaging 0.96
R1477:Trappc12 UTSW 12 28737752 missense probably benign 0.25
R1651:Trappc12 UTSW 12 28691777 missense probably benign 0.32
R1899:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R1900:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R2133:Trappc12 UTSW 12 28746598 missense probably benign 0.00
R2174:Trappc12 UTSW 12 28747381 missense possibly damaging 0.94
R4449:Trappc12 UTSW 12 28747235 missense probably benign 0.05
R5031:Trappc12 UTSW 12 28692513 missense possibly damaging 0.86
R5209:Trappc12 UTSW 12 28737794 missense probably benign 0.03
R5220:Trappc12 UTSW 12 28746697 missense probably damaging 0.97
R5458:Trappc12 UTSW 12 28746390 missense probably damaging 0.98
R5482:Trappc12 UTSW 12 28691325 missense probably damaging 0.97
R5808:Trappc12 UTSW 12 28746864 missense probably damaging 1.00
R5916:Trappc12 UTSW 12 28691514 missense probably damaging 1.00
R5996:Trappc12 UTSW 12 28747114 missense possibly damaging 0.83
R6378:Trappc12 UTSW 12 28747083 missense probably damaging 0.97
R7669:Trappc12 UTSW 12 28711958 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GAGGGAACTAAGCCAGCTTC -3'
(R):5'- TGCTGACCAGTAATCCCAGAC -3'

Sequencing Primer
(F):5'- CAAGTAGGCTCTGCTTCT -3'
(R):5'- TGACCAGTAATCCCAGACTCCTG -3'
Posted On2016-10-06