Incidental Mutation 'R5471:Trim9'
ID433830
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5471 (G1)
Quality Score164
Status Validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70346792 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 126 (I126T)
Ref Sequence ENSEMBL: ENSMUSP00000106151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000167755] [ENSMUST00000221041] [ENSMUST00000221370] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably benign
Transcript: ENSMUST00000110520
AA Change: I126T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: I126T

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110522
AA Change: I126T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: I126T

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167755
AA Change: I126T

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127081
Gene: ENSMUSG00000021071
AA Change: I126T

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221041
AA Change: I126T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: I99T
Predicted Effect probably benign
Transcript: ENSMUST00000221370
AA Change: I126T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000222316
AA Change: I126T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223160
AA Change: I126T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223521
Meta Mutation Damage Score 0.2126 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0622:Trim9 UTSW 12 70346604 missense probably damaging 1.00
R0941:Trim9 UTSW 12 70248263 missense probably damaging 0.97
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1613:Trim9 UTSW 12 70248395 missense probably damaging 1.00
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1722:Trim9 UTSW 12 70248374 missense probably benign 0.33
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3738:Trim9 UTSW 12 70251195 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4560:Trim9 UTSW 12 70347118 nonsense probably null
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
R7549:Trim9 UTSW 12 70346941 missense probably damaging 1.00
R7690:Trim9 UTSW 12 70248343 missense probably benign
R7895:Trim9 UTSW 12 70255187 missense probably benign 0.03
R8003:Trim9 UTSW 12 70346834 missense probably benign 0.39
R8026:Trim9 UTSW 12 70290387 missense probably benign 0.00
R8223:Trim9 UTSW 12 70251015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCGCAGTAGAAGACATCG -3'
(R):5'- GACTATGATTATCTGGACCTGGAC -3'

Sequencing Primer
(F):5'- GCAGTAGAAGACATCGCACTGTTC -3'
(R):5'- CCTGGACAAGATGAGCCTGTAC -3'
Posted On2016-10-06