Incidental Mutation 'R5471:Gcnt2'
ID433833
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Nameglucosaminyl (N-acetyl) transferase 2, I-branching enzyme
SynonymsIGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location40859754-40960892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40860719 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 122 (Y122C)
Ref Sequence ENSEMBL: ENSMUSP00000105820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110191]
Predicted Effect probably damaging
Transcript: ENSMUST00000110191
AA Change: Y122C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: Y122C

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Meta Mutation Damage Score 0.9007 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 40887863 missense probably benign 0.06
IGL01693:Gcnt2 APN 13 40888073 missense probably benign
IGL02506:Gcnt2 APN 13 40887380 missense probably benign 0.02
IGL03184:Gcnt2 APN 13 40888184 missense probably benign 0.01
BB001:Gcnt2 UTSW 13 40918564 nonsense probably null
BB011:Gcnt2 UTSW 13 40918564 nonsense probably null
PIT4472001:Gcnt2 UTSW 13 40917937 missense probably benign 0.39
R0358:Gcnt2 UTSW 13 40860853 missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 40860521 missense probably benign 0.00
R1863:Gcnt2 UTSW 13 40861101 missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 40918606 missense probably benign 0.00
R3156:Gcnt2 UTSW 13 40861178 missense probably benign 0.36
R3893:Gcnt2 UTSW 13 40860446 missense probably benign 0.14
R4134:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 40887807 missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 40888190 missense probably benign 0.17
R4422:Gcnt2 UTSW 13 40860525 nonsense probably null
R4599:Gcnt2 UTSW 13 40887490 missense probably benign
R4618:Gcnt2 UTSW 13 40958194 nonsense probably null
R4908:Gcnt2 UTSW 13 40860734 missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 40918355 missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 40918792 missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 40861176 missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 40918174 missense possibly damaging 0.80
R5472:Gcnt2 UTSW 13 40953579 missense probably benign 0.30
R5493:Gcnt2 UTSW 13 40953600 missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 40860953 missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 40918199 missense probably benign 0.03
R6244:Gcnt2 UTSW 13 40861241 missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 40918697 missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 40887556 frame shift probably null
R7077:Gcnt2 UTSW 13 40860420 missense probably benign
R7432:Gcnt2 UTSW 13 40887212 intron probably benign
R7474:Gcnt2 UTSW 13 40958257 missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 40887681 missense probably benign 0.02
R7599:Gcnt2 UTSW 13 40860867 nonsense probably null
R7678:Gcnt2 UTSW 13 40953719 missense probably benign 0.01
R7806:Gcnt2 UTSW 13 40918241 missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 40860862 missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 40860450 missense probably benign 0.00
R7924:Gcnt2 UTSW 13 40918564 nonsense probably null
R8110:Gcnt2 UTSW 13 40917722 start gained probably benign
R8287:Gcnt2 UTSW 13 40860632 missense probably damaging 1.00
Z1088:Gcnt2 UTSW 13 40918639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGCAGATGTTCAGTG -3'
(R):5'- CTTGGAGGCCACCAGATCTTTC -3'

Sequencing Primer
(F):5'- GGGAGAGTTTTTATACAGCGGAC -3'
(R):5'- CATGCAGTTCAGATCAGCTTG -3'
Posted On2016-10-06