Incidental Mutation 'R5471:Fam83h'
ID433836
Institutional Source Beutler Lab
Gene Symbol Fam83h
Ensembl Gene ENSMUSG00000046761
Gene Namefamily with sequence similarity 83, member H
Synonyms
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76001093-76014336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76002903 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 862 (T862A)
Ref Sequence ENSEMBL: ENSMUSP00000126453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060807] [ENSMUST00000089669] [ENSMUST00000170153]
Predicted Effect probably benign
Transcript: ENSMUST00000060807
AA Change: T862A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059839
Gene: ENSMUSG00000046761
AA Change: T862A

DomainStartEndE-ValueType
Pfam:DUF1669 12 283 3.4e-105 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000089669
SMART Domains Protein: ENSMUSP00000087098
Gene: ENSMUSG00000063704

DomainStartEndE-ValueType
S_TKc 14 305 7.08e-97 SMART
low complexity region 391 404 N/A INTRINSIC
low complexity region 424 434 N/A INTRINSIC
low complexity region 475 505 N/A INTRINSIC
low complexity region 513 525 N/A INTRINSIC
low complexity region 538 548 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160637
Predicted Effect probably benign
Transcript: ENSMUST00000170153
AA Change: T862A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126453
Gene: ENSMUSG00000046761
AA Change: T862A

DomainStartEndE-ValueType
Pfam:DUF1669 4 284 2.1e-110 PFAM
low complexity region 304 317 N/A INTRINSIC
low complexity region 562 578 N/A INTRINSIC
low complexity region 629 652 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
internal_repeat_1 836 877 9.35e-9 PROSPERO
internal_repeat_1 877 921 9.35e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000230929
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays an important role in the structural development and calcification of tooth enamel. Defects in this gene are a cause of amelogenesis imperfecta type 3 (AI3). [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Fam83h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Fam83h APN 15 76004036 missense probably damaging 0.98
IGL01463:Fam83h APN 15 76003788 missense possibly damaging 0.57
IGL01789:Fam83h APN 15 76006120 missense probably damaging 1.00
IGL02029:Fam83h APN 15 76006438 missense probably damaging 1.00
IGL02157:Fam83h APN 15 76005055 missense probably damaging 1.00
IGL03225:Fam83h APN 15 76003301 missense probably damaging 1.00
PIT4260001:Fam83h UTSW 15 76001897 missense probably damaging 1.00
R0008:Fam83h UTSW 15 76003962 missense probably damaging 1.00
R0071:Fam83h UTSW 15 76002528 missense probably benign
R0318:Fam83h UTSW 15 76003629 missense probably benign 0.04
R0539:Fam83h UTSW 15 76003227 missense possibly damaging 0.88
R0638:Fam83h UTSW 15 76003927 missense probably benign 0.01
R0790:Fam83h UTSW 15 76003392 missense probably benign 0.43
R0883:Fam83h UTSW 15 76006169 missense probably damaging 1.00
R1970:Fam83h UTSW 15 76006570 unclassified probably benign
R2046:Fam83h UTSW 15 76002938 missense probably benign
R2114:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2115:Fam83h UTSW 15 76002297 missense probably damaging 1.00
R2117:Fam83h UTSW 15 76004733 nonsense probably null
R3702:Fam83h UTSW 15 76002650 missense probably benign
R3842:Fam83h UTSW 15 76002650 missense probably benign
R4729:Fam83h UTSW 15 76002336 missense probably benign
R4791:Fam83h UTSW 15 76002368 missense probably damaging 1.00
R5024:Fam83h UTSW 15 76005142 missense probably damaging 1.00
R6013:Fam83h UTSW 15 76004000 missense probably damaging 0.99
R6488:Fam83h UTSW 15 76002053 missense possibly damaging 0.67
R6558:Fam83h UTSW 15 76004453 missense probably damaging 1.00
R6618:Fam83h UTSW 15 76003511 missense probably damaging 1.00
R7030:Fam83h UTSW 15 76004739 missense probably benign 0.08
R7148:Fam83h UTSW 15 76005167 missense probably damaging 0.98
R7191:Fam83h UTSW 15 76003037 missense probably damaging 1.00
R7438:Fam83h UTSW 15 76004426 missense possibly damaging 0.93
R7705:Fam83h UTSW 15 76003850 missense probably damaging 0.99
R8194:Fam83h UTSW 15 76002775 small deletion probably benign
R8218:Fam83h UTSW 15 76003037 missense probably damaging 1.00
X0010:Fam83h UTSW 15 76004939 critical splice donor site probably null
X0061:Fam83h UTSW 15 76003503 missense probably damaging 1.00
Z1177:Fam83h UTSW 15 76002962 missense probably benign 0.00
Z1177:Fam83h UTSW 15 76006541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAATCCTGTGGTTGGGC -3'
(R):5'- ATTCCTTTGCCCAGCAGTTG -3'

Sequencing Primer
(F):5'- TGCCCCTCCGATTGGGAAATC -3'
(R):5'- CAGCAGTTGCACCAGGAG -3'
Posted On2016-10-06