Incidental Mutation 'R5471:Zfp397'
ID433838
Institutional Source Beutler Lab
Gene Symbol Zfp397
Ensembl Gene ENSMUSG00000024276
Gene Namezinc finger protein 397
Synonyms
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location23954692-23964673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23960024 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 189 (N189D)
Ref Sequence ENSEMBL: ENSMUSP00000057253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060762] [ENSMUST00000225682]
Predicted Effect probably benign
Transcript: ENSMUST00000060762
AA Change: N189D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000057253
Gene: ENSMUSG00000024276
AA Change: N189D

DomainStartEndE-ValueType
SCAN 46 158 4e-68 SMART
ZnF_C2H2 278 300 1.58e-3 SMART
ZnF_C2H2 306 328 7.37e-4 SMART
ZnF_C2H2 334 356 1.22e-4 SMART
ZnF_C2H2 362 384 9.58e-3 SMART
ZnF_C2H2 390 412 3.95e-4 SMART
ZnF_C2H2 418 440 1.6e-4 SMART
ZnF_C2H2 446 468 4.54e-4 SMART
ZnF_C2H2 474 496 3.49e-5 SMART
ZnF_C2H2 502 524 2.12e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224107
Predicted Effect probably benign
Transcript: ENSMUST00000225682
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Exoc6 A G 19: 37,599,617 D566G probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Other mutations in Zfp397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01903:Zfp397 APN 18 23960029 missense probably benign
ANU22:Zfp397 UTSW 18 23960751 missense probably damaging 1.00
R1986:Zfp397 UTSW 18 23960051 missense possibly damaging 0.72
R4676:Zfp397 UTSW 18 23960797 nonsense probably null
R4824:Zfp397 UTSW 18 23960192 missense probably benign 0.02
R5735:Zfp397 UTSW 18 23960192 missense possibly damaging 0.76
R7134:Zfp397 UTSW 18 23957065 missense probably benign
R7231:Zfp397 UTSW 18 23960358 missense probably damaging 1.00
R7753:Zfp397 UTSW 18 23957072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCAGGGAACAATTACATCTTTG -3'
(R):5'- AGATGGTCTCTCTTTGCTAAGG -3'

Sequencing Primer
(F):5'- CTCAGGACCTCTGGAAGATCAGTTG -3'
(R):5'- GCTAAGGATTTGTGTGTGAAGATC -3'
Posted On2016-10-06