Incidental Mutation 'R5472:Cxcr4'
ID433844
Institutional Source Beutler Lab
Gene Symbol Cxcr4
Ensembl Gene ENSMUSG00000045382
Gene Namechemokine (C-X-C motif) receptor 4
Synonymsfusin, Cmkar4, CD184, Sdf1r, b2b220Clo, PB-CKR
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128588199-128592293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128589625 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 100 (A100S)
Ref Sequence ENSEMBL: ENSMUSP00000053489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052172] [ENSMUST00000142893]
Predicted Effect probably damaging
Transcript: ENSMUST00000052172
AA Change: A100S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053489
Gene: ENSMUSG00000045382
AA Change: A100S

DomainStartEndE-ValueType
Pfam:CXCR4_N 8 40 2.1e-18 PFAM
Pfam:7TM_GPCR_Srsx 51 323 2.5e-7 PFAM
Pfam:7tm_1 57 309 2.4e-52 PFAM
low complexity region 344 359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142893
AA Change: A98S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120153
Gene: ENSMUSG00000045382
AA Change: A98S

DomainStartEndE-ValueType
Pfam:CXCR4_N 6 38 1.5e-24 PFAM
Pfam:7TM_GPCR_Srsx 49 270 2.4e-8 PFAM
Pfam:7tm_1 55 272 1.9e-51 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants exhibit altered viability, lungs, kidneys, immune system, hematopoiesis, myelopoiesis, cerebellar foliation, neuronal cell layer development, susceptibility to diet-induced obesity and adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Cxcr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Cxcr4 APN 1 128589055 missense probably damaging 1.00
IGL01343:Cxcr4 APN 1 128589555 missense probably damaging 1.00
IGL03202:Cxcr4 APN 1 128588904 missense probably damaging 1.00
Rubber_ducky UTSW 1 128589450 missense probably damaging 1.00
R1728:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1729:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1730:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1739:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1762:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1783:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1784:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R1785:Cxcr4 UTSW 1 128589277 missense probably benign 0.00
R2356:Cxcr4 UTSW 1 128589514 missense probably damaging 1.00
R5199:Cxcr4 UTSW 1 128589546 missense probably damaging 1.00
R5969:Cxcr4 UTSW 1 128589847 missense probably benign
R6124:Cxcr4 UTSW 1 128589660 missense probably damaging 1.00
R6211:Cxcr4 UTSW 1 128589450 missense probably damaging 1.00
R6228:Cxcr4 UTSW 1 128592183 splice site probably null
R6349:Cxcr4 UTSW 1 128589277 missense possibly damaging 0.78
R6458:Cxcr4 UTSW 1 128589094 missense probably benign 0.05
R6949:Cxcr4 UTSW 1 128589615 missense probably benign
R7230:Cxcr4 UTSW 1 128589790 missense probably damaging 0.98
R7715:Cxcr4 UTSW 1 128589742 missense probably damaging 1.00
R8040:Cxcr4 UTSW 1 128589798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGACTGCCTTTTCAGCCAG -3'
(R):5'- AACAAGGAACCCTGCTTCCG -3'

Sequencing Primer
(F):5'- AGCCAGCAGTTTCCTTGG -3'
(R):5'- TCCGGGATGAAAACGTCCATTTC -3'
Posted On2016-10-06