Mutagenetix > Incidental Mutation

Incidental Mutation 'R5472:Brinp3'

433845

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

043033-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R5472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146901459 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 548 (H548L)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074622
AA Change: H548L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: H548L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166814
AA Change: H548L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: H548L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,513,429	N506S	probably benign	Het
BC067074	A	G	13: 113,319,169	D583G	probably benign	Het
Cacna1c	A	G	6: 118,638,446	V1328A	possibly damaging	Het
Carmil1	C	T	13: 24,155,471	V47I	probably damaging	Het
Cdk2ap2	C	A	19: 4,098,048	T76K	probably benign	Het
Col16a1	T	C	4: 130,092,771		probably benign	Het
Cxcr4	C	A	1: 128,589,625	A100S	probably damaging	Het
Fancl	G	T	11: 26,469,677	C305F	probably damaging	Het
Gcnt2	T	C	13: 40,953,579	V308A	probably benign	Het
Gm11733	A	T	11: 117,484,496	I24L	unknown	Het
Gm765	A	T	6: 98,238,276	C129S	probably damaging	Het
Gm973	A	G	1: 59,628,287		probably null	Het
Gm996	T	C	2: 25,579,702	T66A	probably benign	Het
Heatr5b	A	T	17: 78,801,660	F1057I	probably damaging	Het
Ifi213	A	T	1: 173,567,272		probably null	Het
Ighv1-20	A	T	12: 114,723,851	V91E	probably damaging	Het
Inhba	A	G	13: 16,026,786	E311G	probably damaging	Het
Irx3	G	T	8: 91,799,480		probably null	Het
Jag1	C	A	2: 137,084,995	C948F	probably damaging	Het
Kcna2	T	C	3: 107,105,309	I402T	possibly damaging	Het
Kcnh8	A	T	17: 52,977,816	Q938L	possibly damaging	Het
Lrsam1	ACC	AC	2: 32,945,858		probably null	Het
Macf1	T	C	4: 123,450,061	T2123A	probably benign	Het
Mdh1	A	T	11: 21,559,786	N196K	probably benign	Het
Msh6	G	A	17: 87,984,561	R248Q	possibly damaging	Het
Odf2l	G	T	3: 145,146,866	R457L	probably benign	Het
Olfr822	A	T	10: 130,075,029	L206F	probably damaging	Het
Pphln1	T	C	15: 93,488,975	V318A	possibly damaging	Het
Ppp1r12a	C	T	10: 108,240,112	T267I	probably damaging	Het
Pramef20	T	C	4: 144,377,157	D133G	probably benign	Het
Prpf8	A	C	11: 75,503,643	K1801N	possibly damaging	Het
Raf1	A	G	6: 115,626,706		probably null	Het
Rasal3	C	A	17: 32,396,669	L374F	probably damaging	Het
S1pr3	T	A	13: 51,419,647	V288D	probably damaging	Het
Setd7	G	A	3: 51,521,465	P315S	probably benign	Het
Slx4	C	T	16: 3,991,540	A364T	probably benign	Het
Sp7	G	A	15: 102,359,314	T19I	probably benign	Het
Tlr9	T	A	9: 106,224,313	C268S	probably damaging	Het
Tmem117	T	A	15: 95,094,513	D351E	possibly damaging	Het
Tmem45b	T	A	9: 31,428,044	D211V	possibly damaging	Het
Tns3	A	G	11: 8,451,092	S1069P	probably benign	Het
Tsnax	A	G	8: 125,015,762	I77V	probably benign	Het
Txndc5	G	A	13: 38,513,125	L79F	possibly damaging	Het
Ube2q1	A	G	3: 89,777,241	E14G	probably benign	Het
Vmn2r28	C	T	7: 5,487,944		probably null	Het
Vwde	A	T	6: 13,193,118	D407E	probably benign	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Zfp109	A	T	7: 24,228,621	C462*	probably null	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTCTGCAAGCCTGAAGTCG -3'
(R):5'- TAGAGGGAGGTCCAGCTTAG -3'

Sequencing Primer
(F):5'- ACATTGGCTTTGAGACCGAC -3'
(R):5'- AGGTCCAGCTTAGTCCGCTC -3'

Posted On

2016-10-06