Incidental Mutation 'R5472:Ifi213'
ID 433846
Institutional Source Beutler Lab
Gene Symbol Ifi213
Ensembl Gene ENSMUSG00000073491
Gene Name interferon activated gene 213
Synonyms Pyr-A, Pydc4, E030037K03Rik
MMRRC Submission 043033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5472 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173393849-173426840 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 173394838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150649] [ENSMUST00000150649]
AlphaFold D3Z5G0
Predicted Effect probably null
Transcript: ENSMUST00000150649
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150649
SMART Domains Protein: ENSMUSP00000117222
Gene: ENSMUSG00000073491

DomainStartEndE-ValueType
PYRIN 10 88 3.71e-20 SMART
low complexity region 101 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179648
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ajm1 T C 2: 25,469,714 (GRCm39) T66A probably benign Het
Akap11 T C 14: 78,750,869 (GRCm39) N506S probably benign Het
Brinp3 A T 1: 146,777,197 (GRCm39) H548L possibly damaging Het
Cacna1c A G 6: 118,615,407 (GRCm39) V1328A possibly damaging Het
Carmil1 C T 13: 24,339,454 (GRCm39) V47I probably damaging Het
Cdk2ap2 C A 19: 4,148,048 (GRCm39) T76K probably benign Het
Col16a1 T C 4: 129,986,564 (GRCm39) probably benign Het
Cspg4b A G 13: 113,455,703 (GRCm39) D583G probably benign Het
Cxcr4 C A 1: 128,517,362 (GRCm39) A100S probably damaging Het
Fancl G T 11: 26,419,677 (GRCm39) C305F probably damaging Het
Gcnt2 T C 13: 41,107,055 (GRCm39) V308A probably benign Het
Gm11733 A T 11: 117,375,322 (GRCm39) I24L unknown Het
Gm973 A G 1: 59,667,446 (GRCm39) probably null Het
Heatr5b A T 17: 79,109,089 (GRCm39) F1057I probably damaging Het
Ighv1-20 A T 12: 114,687,471 (GRCm39) V91E probably damaging Het
Inhba A G 13: 16,201,371 (GRCm39) E311G probably damaging Het
Irx3 G T 8: 92,526,108 (GRCm39) probably null Het
Jag1 C A 2: 136,926,915 (GRCm39) C948F probably damaging Het
Kcna2 T C 3: 107,012,625 (GRCm39) I402T possibly damaging Het
Kcnh8 A T 17: 53,284,844 (GRCm39) Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,835,870 (GRCm39) probably null Het
Macf1 T C 4: 123,343,854 (GRCm39) T2123A probably benign Het
Mdfic2 A T 6: 98,215,237 (GRCm39) C129S probably damaging Het
Mdh1 A T 11: 21,509,786 (GRCm39) N196K probably benign Het
Msh6 G A 17: 88,291,989 (GRCm39) R248Q possibly damaging Het
Odf2l G T 3: 144,852,627 (GRCm39) R457L probably benign Het
Or6c69c A T 10: 129,910,898 (GRCm39) L206F probably damaging Het
Pphln1 T C 15: 93,386,856 (GRCm39) V318A possibly damaging Het
Ppp1r12a C T 10: 108,075,973 (GRCm39) T267I probably damaging Het
Pramel15 T C 4: 144,103,727 (GRCm39) D133G probably benign Het
Prpf8 A C 11: 75,394,469 (GRCm39) K1801N possibly damaging Het
Raf1 A G 6: 115,603,667 (GRCm39) probably null Het
Rasal3 C A 17: 32,615,643 (GRCm39) L374F probably damaging Het
S1pr3 T A 13: 51,573,683 (GRCm39) V288D probably damaging Het
Setd7 G A 3: 51,428,886 (GRCm39) P315S probably benign Het
Slx4 C T 16: 3,809,404 (GRCm39) A364T probably benign Het
Sp7 G A 15: 102,267,749 (GRCm39) T19I probably benign Het
Tlr9 T A 9: 106,101,512 (GRCm39) C268S probably damaging Het
Tmem117 T A 15: 94,992,394 (GRCm39) D351E possibly damaging Het
Tmem45b T A 9: 31,339,340 (GRCm39) D211V possibly damaging Het
Tns3 A G 11: 8,401,092 (GRCm39) S1069P probably benign Het
Tsnax A G 8: 125,742,501 (GRCm39) I77V probably benign Het
Txndc5 G A 13: 38,697,101 (GRCm39) L79F possibly damaging Het
Ube2q1 A G 3: 89,684,548 (GRCm39) E14G probably benign Het
Vmn2r28 C T 7: 5,490,943 (GRCm39) probably null Het
Vwde A T 6: 13,193,117 (GRCm39) D407E probably benign Het
Wdr35 T A 12: 9,066,619 (GRCm39) M749K probably benign Het
Zfp109 A T 7: 23,928,046 (GRCm39) C462* probably null Het
Other mutations in Ifi213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Ifi213 APN 1 173,421,619 (GRCm39) splice site probably benign
IGL00908:Ifi213 APN 1 173,422,649 (GRCm39) missense probably damaging 1.00
IGL00964:Ifi213 APN 1 173,421,518 (GRCm39) missense possibly damaging 0.91
IGL02217:Ifi213 APN 1 173,422,598 (GRCm39) missense possibly damaging 0.91
R0709:Ifi213 UTSW 1 173,417,366 (GRCm39) missense possibly damaging 0.70
R1518:Ifi213 UTSW 1 173,417,229 (GRCm39) missense probably damaging 0.99
R1559:Ifi213 UTSW 1 173,394,784 (GRCm39) missense probably benign 0.18
R1822:Ifi213 UTSW 1 173,417,408 (GRCm39) missense probably damaging 0.99
R1839:Ifi213 UTSW 1 173,417,166 (GRCm39) missense probably damaging 0.98
R1989:Ifi213 UTSW 1 173,396,374 (GRCm39) critical splice donor site probably null
R2108:Ifi213 UTSW 1 173,396,668 (GRCm39) critical splice acceptor site probably null
R2696:Ifi213 UTSW 1 173,417,590 (GRCm39) missense probably benign
R3890:Ifi213 UTSW 1 173,394,822 (GRCm39) missense probably benign 0.33
R4544:Ifi213 UTSW 1 173,409,693 (GRCm39) splice site probably null
R4611:Ifi213 UTSW 1 173,417,480 (GRCm39) missense possibly damaging 0.91
R4689:Ifi213 UTSW 1 173,417,986 (GRCm39) missense possibly damaging 0.92
R4710:Ifi213 UTSW 1 173,394,738 (GRCm39) utr 3 prime probably benign
R5126:Ifi213 UTSW 1 173,417,581 (GRCm39) missense possibly damaging 0.85
R5625:Ifi213 UTSW 1 173,396,629 (GRCm39) missense possibly damaging 0.73
R5789:Ifi213 UTSW 1 173,396,360 (GRCm39) splice site probably benign
R5898:Ifi213 UTSW 1 173,396,545 (GRCm39) missense probably benign 0.01
R6025:Ifi213 UTSW 1 173,422,800 (GRCm39) missense probably damaging 0.99
R6149:Ifi213 UTSW 1 173,421,581 (GRCm39) missense probably benign 0.18
R6348:Ifi213 UTSW 1 173,417,848 (GRCm39) missense possibly damaging 0.46
R6564:Ifi213 UTSW 1 173,422,862 (GRCm39) start codon destroyed probably null 0.06
R7254:Ifi213 UTSW 1 173,421,529 (GRCm39) missense probably damaging 0.98
R7292:Ifi213 UTSW 1 173,422,691 (GRCm39) missense probably damaging 0.99
R7752:Ifi213 UTSW 1 173,394,784 (GRCm39) missense probably benign 0.18
R7901:Ifi213 UTSW 1 173,394,784 (GRCm39) missense probably benign 0.18
R8100:Ifi213 UTSW 1 173,422,748 (GRCm39) missense probably damaging 1.00
R8352:Ifi213 UTSW 1 173,422,835 (GRCm39) missense possibly damaging 0.92
R8425:Ifi213 UTSW 1 173,417,426 (GRCm39) missense probably benign
R8452:Ifi213 UTSW 1 173,422,835 (GRCm39) missense possibly damaging 0.92
R9357:Ifi213 UTSW 1 173,396,392 (GRCm39) missense probably benign 0.01
RF010:Ifi213 UTSW 1 173,409,719 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGAAATTCCAAGCCCAGGG -3'
(R):5'- GTCATGCCATTACCTTATAATGCAA -3'

Sequencing Primer
(F):5'- ATTCATGCTACAGGGATGCC -3'
(R):5'- GCCATTACCTTATAATGCAACCATTG -3'
Posted On 2016-10-06