Incidental Mutation 'R5472:Ajm1'
ID 433849
Institutional Source Beutler Lab
Gene Symbol Ajm1
Ensembl Gene ENSMUSG00000029419
Gene Name apical junction component 1
Synonyms Gm996, LOC381353
MMRRC Submission 043033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.117) question?
Stock # R5472 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 25465428-25471760 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25469714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 66 (T66A)
Ref Sequence ENSEMBL: ENSMUSP00000140109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000188161] [ENSMUST00000191602] [ENSMUST00000187017]
AlphaFold A2AJA9
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114217
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419
AA Change: T66A

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147096
Predicted Effect probably benign
Transcript: ENSMUST00000188161
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419
AA Change: T66A

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191602
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419
AA Change: T66A

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181730
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,750,869 (GRCm39) N506S probably benign Het
Brinp3 A T 1: 146,777,197 (GRCm39) H548L possibly damaging Het
Cacna1c A G 6: 118,615,407 (GRCm39) V1328A possibly damaging Het
Carmil1 C T 13: 24,339,454 (GRCm39) V47I probably damaging Het
Cdk2ap2 C A 19: 4,148,048 (GRCm39) T76K probably benign Het
Col16a1 T C 4: 129,986,564 (GRCm39) probably benign Het
Cspg4b A G 13: 113,455,703 (GRCm39) D583G probably benign Het
Cxcr4 C A 1: 128,517,362 (GRCm39) A100S probably damaging Het
Fancl G T 11: 26,419,677 (GRCm39) C305F probably damaging Het
Gcnt2 T C 13: 41,107,055 (GRCm39) V308A probably benign Het
Gm11733 A T 11: 117,375,322 (GRCm39) I24L unknown Het
Gm973 A G 1: 59,667,446 (GRCm39) probably null Het
Heatr5b A T 17: 79,109,089 (GRCm39) F1057I probably damaging Het
Ifi213 A T 1: 173,394,838 (GRCm39) probably null Het
Ighv1-20 A T 12: 114,687,471 (GRCm39) V91E probably damaging Het
Inhba A G 13: 16,201,371 (GRCm39) E311G probably damaging Het
Irx3 G T 8: 92,526,108 (GRCm39) probably null Het
Jag1 C A 2: 136,926,915 (GRCm39) C948F probably damaging Het
Kcna2 T C 3: 107,012,625 (GRCm39) I402T possibly damaging Het
Kcnh8 A T 17: 53,284,844 (GRCm39) Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,835,870 (GRCm39) probably null Het
Macf1 T C 4: 123,343,854 (GRCm39) T2123A probably benign Het
Mdfic2 A T 6: 98,215,237 (GRCm39) C129S probably damaging Het
Mdh1 A T 11: 21,509,786 (GRCm39) N196K probably benign Het
Msh6 G A 17: 88,291,989 (GRCm39) R248Q possibly damaging Het
Odf2l G T 3: 144,852,627 (GRCm39) R457L probably benign Het
Or6c69c A T 10: 129,910,898 (GRCm39) L206F probably damaging Het
Pphln1 T C 15: 93,386,856 (GRCm39) V318A possibly damaging Het
Ppp1r12a C T 10: 108,075,973 (GRCm39) T267I probably damaging Het
Pramel15 T C 4: 144,103,727 (GRCm39) D133G probably benign Het
Prpf8 A C 11: 75,394,469 (GRCm39) K1801N possibly damaging Het
Raf1 A G 6: 115,603,667 (GRCm39) probably null Het
Rasal3 C A 17: 32,615,643 (GRCm39) L374F probably damaging Het
S1pr3 T A 13: 51,573,683 (GRCm39) V288D probably damaging Het
Setd7 G A 3: 51,428,886 (GRCm39) P315S probably benign Het
Slx4 C T 16: 3,809,404 (GRCm39) A364T probably benign Het
Sp7 G A 15: 102,267,749 (GRCm39) T19I probably benign Het
Tlr9 T A 9: 106,101,512 (GRCm39) C268S probably damaging Het
Tmem117 T A 15: 94,992,394 (GRCm39) D351E possibly damaging Het
Tmem45b T A 9: 31,339,340 (GRCm39) D211V possibly damaging Het
Tns3 A G 11: 8,401,092 (GRCm39) S1069P probably benign Het
Tsnax A G 8: 125,742,501 (GRCm39) I77V probably benign Het
Txndc5 G A 13: 38,697,101 (GRCm39) L79F possibly damaging Het
Ube2q1 A G 3: 89,684,548 (GRCm39) E14G probably benign Het
Vmn2r28 C T 7: 5,490,943 (GRCm39) probably null Het
Vwde A T 6: 13,193,117 (GRCm39) D407E probably benign Het
Wdr35 T A 12: 9,066,619 (GRCm39) M749K probably benign Het
Zfp109 A T 7: 23,928,046 (GRCm39) C462* probably null Het
Other mutations in Ajm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ajm1 APN 2 25,469,419 (GRCm39) missense probably damaging 0.97
IGL01370:Ajm1 APN 2 25,468,969 (GRCm39) missense possibly damaging 0.82
IGL01973:Ajm1 APN 2 25,469,584 (GRCm39) nonsense probably null
IGL01987:Ajm1 APN 2 25,467,970 (GRCm39) missense possibly damaging 0.82
IGL02534:Ajm1 APN 2 25,467,043 (GRCm39) nonsense probably null
R0457:Ajm1 UTSW 2 25,468,358 (GRCm39) missense possibly damaging 0.66
R0799:Ajm1 UTSW 2 25,468,574 (GRCm39) missense possibly damaging 0.83
R0931:Ajm1 UTSW 2 25,468,501 (GRCm39) missense possibly damaging 0.82
R1243:Ajm1 UTSW 2 25,468,570 (GRCm39) missense possibly damaging 0.66
R1477:Ajm1 UTSW 2 25,469,765 (GRCm39) missense possibly damaging 0.66
R1559:Ajm1 UTSW 2 25,467,043 (GRCm39) nonsense probably null
R1661:Ajm1 UTSW 2 25,469,167 (GRCm39) missense possibly damaging 0.90
R1796:Ajm1 UTSW 2 25,468,000 (GRCm39) missense probably damaging 1.00
R3955:Ajm1 UTSW 2 25,467,583 (GRCm39) nonsense probably null
R4005:Ajm1 UTSW 2 25,468,868 (GRCm39) missense probably benign 0.01
R4342:Ajm1 UTSW 2 25,469,120 (GRCm39) missense possibly damaging 0.92
R4579:Ajm1 UTSW 2 25,469,661 (GRCm39) missense possibly damaging 0.66
R4621:Ajm1 UTSW 2 25,468,412 (GRCm39) missense probably damaging 0.96
R4770:Ajm1 UTSW 2 25,469,759 (GRCm39) missense possibly damaging 0.94
R4834:Ajm1 UTSW 2 25,469,530 (GRCm39) missense possibly damaging 0.82
R4860:Ajm1 UTSW 2 25,468,765 (GRCm39) missense probably damaging 0.99
R4860:Ajm1 UTSW 2 25,468,765 (GRCm39) missense probably damaging 0.99
R4887:Ajm1 UTSW 2 25,469,759 (GRCm39) missense possibly damaging 0.94
R4888:Ajm1 UTSW 2 25,469,759 (GRCm39) missense possibly damaging 0.94
R5632:Ajm1 UTSW 2 25,469,276 (GRCm39) missense probably benign
R6816:Ajm1 UTSW 2 25,469,733 (GRCm39) frame shift probably null
R6818:Ajm1 UTSW 2 25,469,733 (GRCm39) frame shift probably null
R6861:Ajm1 UTSW 2 25,469,733 (GRCm39) frame shift probably null
R7164:Ajm1 UTSW 2 25,468,579 (GRCm39) missense possibly damaging 0.66
R7543:Ajm1 UTSW 2 25,467,410 (GRCm39) missense possibly damaging 0.81
R7748:Ajm1 UTSW 2 25,468,971 (GRCm39) missense possibly damaging 0.46
R7783:Ajm1 UTSW 2 25,467,820 (GRCm39) missense probably damaging 0.97
R7826:Ajm1 UTSW 2 25,468,477 (GRCm39) missense possibly damaging 0.66
R8117:Ajm1 UTSW 2 25,469,246 (GRCm39) missense probably benign 0.27
R8694:Ajm1 UTSW 2 25,469,831 (GRCm39) missense possibly damaging 0.83
R8708:Ajm1 UTSW 2 25,467,814 (GRCm39) missense possibly damaging 0.66
R8830:Ajm1 UTSW 2 25,467,262 (GRCm39) missense
R8904:Ajm1 UTSW 2 25,467,914 (GRCm39) missense probably benign 0.27
R8928:Ajm1 UTSW 2 25,468,577 (GRCm39) missense possibly damaging 0.92
R9253:Ajm1 UTSW 2 25,467,172 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATGGGGTGCAGCTCATTAG -3'
(R):5'- TTAAGATGACCCGCACGGAC -3'

Sequencing Primer
(F):5'- TCTCAGCGCAGGATACGAG -3'
(R):5'- ACCCGCCGGACTTGCTG -3'
Posted On 2016-10-06