Incidental Mutation 'R5472:Gm996'
ID433849
Institutional Source Beutler Lab
Gene Symbol Gm996
Ensembl Gene ENSMUSG00000029419
Gene Namepredicted gene 996
SynonymsLOC381353
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25575416-25581757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25579702 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 66 (T66A)
Ref Sequence ENSEMBL: ENSMUSP00000140109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039156] [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
Predicted Effect probably benign
Transcript: ENSMUST00000039156
SMART Domains Protein: ENSMUSP00000037417
Gene: ENSMUSG00000036504

DomainStartEndE-ValueType
Pfam:Ocnus 5 116 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058137
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114217
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419
AA Change: T66A

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181730
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect probably benign
Transcript: ENSMUST00000188161
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419
AA Change: T66A

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191602
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419
AA Change: T66A

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Gm996
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Gm996 APN 2 25579407 missense probably damaging 0.97
IGL01370:Gm996 APN 2 25578957 missense possibly damaging 0.82
IGL01973:Gm996 APN 2 25579572 nonsense probably null
IGL01987:Gm996 APN 2 25577958 missense possibly damaging 0.82
IGL02534:Gm996 APN 2 25577031 nonsense probably null
R0457:Gm996 UTSW 2 25578346 missense possibly damaging 0.66
R0799:Gm996 UTSW 2 25578562 missense possibly damaging 0.83
R0931:Gm996 UTSW 2 25578489 missense possibly damaging 0.82
R1243:Gm996 UTSW 2 25578558 missense possibly damaging 0.66
R1477:Gm996 UTSW 2 25579753 missense possibly damaging 0.66
R1559:Gm996 UTSW 2 25577031 nonsense probably null
R1661:Gm996 UTSW 2 25579155 missense possibly damaging 0.90
R1796:Gm996 UTSW 2 25577988 missense probably damaging 1.00
R3955:Gm996 UTSW 2 25577571 nonsense probably null
R4005:Gm996 UTSW 2 25578856 missense probably benign 0.01
R4342:Gm996 UTSW 2 25579108 missense possibly damaging 0.92
R4579:Gm996 UTSW 2 25579649 missense possibly damaging 0.66
R4621:Gm996 UTSW 2 25578400 missense probably damaging 0.96
R4770:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4834:Gm996 UTSW 2 25579518 missense possibly damaging 0.82
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4860:Gm996 UTSW 2 25578753 missense probably damaging 0.99
R4887:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R4888:Gm996 UTSW 2 25579747 missense possibly damaging 0.94
R5632:Gm996 UTSW 2 25579264 missense probably benign
R6816:Gm996 UTSW 2 25579721 frame shift probably null
R6818:Gm996 UTSW 2 25579721 frame shift probably null
R6861:Gm996 UTSW 2 25579721 frame shift probably null
R7164:Gm996 UTSW 2 25578567 missense possibly damaging 0.66
R7543:Gm996 UTSW 2 25577398 missense possibly damaging 0.81
R7748:Gm996 UTSW 2 25578959 missense possibly damaging 0.46
R7783:Gm996 UTSW 2 25577808 missense probably damaging 0.97
R7826:Gm996 UTSW 2 25578465 missense possibly damaging 0.66
R8117:Gm996 UTSW 2 25579234 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATGGGGTGCAGCTCATTAG -3'
(R):5'- TTAAGATGACCCGCACGGAC -3'

Sequencing Primer
(F):5'- TCTCAGCGCAGGATACGAG -3'
(R):5'- ACCCGCCGGACTTGCTG -3'
Posted On2016-10-06