Incidental Mutation 'R5472:Ube2q1'
ID433855
Institutional Source Beutler Lab
Gene Symbol Ube2q1
Ensembl Gene ENSMUSG00000042572
Gene Nameubiquitin-conjugating enzyme E2Q family member 1
SynonymsPRO3094, 2310012M18Rik, NICE-5, 1110002C01Rik
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R5472 (G1)
Quality Score182
Status Not validated
Chromosome3
Chromosomal Location89773616-89784000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89777241 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 14 (E14G)
Ref Sequence ENSEMBL: ENSMUSP00000143422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038356] [ENSMUST00000196726]
Predicted Effect probably benign
Transcript: ENSMUST00000038356
AA Change: E183G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037939
Gene: ENSMUSG00000042572
AA Change: E183G

DomainStartEndE-ValueType
low complexity region 2 39 N/A INTRINSIC
Blast:RWD 43 156 1e-42 BLAST
low complexity region 183 202 N/A INTRINSIC
Blast:UBCc 203 243 8e-13 BLAST
UBCc 254 415 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195940
Predicted Effect probably benign
Transcript: ENSMUST00000196726
AA Change: E14G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143422
Gene: ENSMUSG00000042572
AA Change: E14G

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Blast:UBCc 34 74 1e-13 BLAST
UBCc 85 246 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199427
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is 98% identical to the mouse counterpart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female-specific pleiotropic reproductive defects and partial embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Ube2q1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Ube2q1 APN 3 89781374 missense probably damaging 1.00
IGL02121:Ube2q1 APN 3 89780462 missense possibly damaging 0.55
R0165:Ube2q1 UTSW 3 89776153 missense probably damaging 1.00
R1680:Ube2q1 UTSW 3 89776176 missense probably benign 0.01
R2072:Ube2q1 UTSW 3 89779571 critical splice donor site probably null
R3548:Ube2q1 UTSW 3 89781076 missense probably damaging 1.00
R4932:Ube2q1 UTSW 3 89779483 nonsense probably null
R5902:Ube2q1 UTSW 3 89776180 nonsense probably null
R6161:Ube2q1 UTSW 3 89781360 splice site probably null
R7303:Ube2q1 UTSW 3 89776591 missense possibly damaging 0.91
RF022:Ube2q1 UTSW 3 89780893 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAAGCAGCTATGGCATGTG -3'
(R):5'- GCAGGCCAGTCAGTCTTTATC -3'

Sequencing Primer
(F):5'- AAAGTCATCCATGCCTTGGG -3'
(R):5'- AGGCCAGTCAGTCTTTATCCTATTG -3'
Posted On2016-10-06