Incidental Mutation 'R5472:Kcna2'
ID433856
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 2
SynonymsMk-2, Akr6a4, Kca1-2, Kv1.2
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107101146-107115005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107105309 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 402 (I402T)
Ref Sequence ENSEMBL: ENSMUSP00000143798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038695
AA Change: I402T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: I402T

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196403
AA Change: I402T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: I402T

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197470
AA Change: I402T

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: I402T

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1838:Kcna2 UTSW 3 107104512 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4662:Kcna2 UTSW 3 107105417 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107105498 missense probably benign 0.00
R5205:Kcna2 UTSW 3 107097146 unclassified probably benign
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R7216:Kcna2 UTSW 3 107104793 missense probably damaging 0.99
R7304:Kcna2 UTSW 3 107104750 missense probably benign
R7538:Kcna2 UTSW 3 107104568 missense probably benign 0.31
R7585:Kcna2 UTSW 3 107105342 missense probably damaging 1.00
R7968:Kcna2 UTSW 3 107105144 missense possibly damaging 0.79
R8241:Kcna2 UTSW 3 107105022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCATGAGGGAATTGGGCC -3'
(R):5'- GTGTTAGCCAAGGTACAGTTGG -3'

Sequencing Primer
(F):5'- AGGGAATTGGGCCTCCTGATATTC -3'
(R):5'- AAGTCCTCATTGCTGTTGTTAAC -3'
Posted On2016-10-06