Mutagenetix > Incidental Mutation

Incidental Mutation 'R5472:Tlr9'

433874

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

043033-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R5472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106224313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 268 (C268S)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062241
AA Change: C268S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: C268S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,513,429	N506S	probably benign	Het
BC067074	A	G	13: 113,319,169	D583G	probably benign	Het
Brinp3	A	T	1: 146,901,459	H548L	possibly damaging	Het
Cacna1c	A	G	6: 118,638,446	V1328A	possibly damaging	Het
Carmil1	C	T	13: 24,155,471	V47I	probably damaging	Het
Cdk2ap2	C	A	19: 4,098,048	T76K	probably benign	Het
Col16a1	T	C	4: 130,092,771		probably benign	Het
Cxcr4	C	A	1: 128,589,625	A100S	probably damaging	Het
Fancl	G	T	11: 26,469,677	C305F	probably damaging	Het
Gcnt2	T	C	13: 40,953,579	V308A	probably benign	Het
Gm11733	A	T	11: 117,484,496	I24L	unknown	Het
Gm765	A	T	6: 98,238,276	C129S	probably damaging	Het
Gm973	A	G	1: 59,628,287		probably null	Het
Gm996	T	C	2: 25,579,702	T66A	probably benign	Het
Heatr5b	A	T	17: 78,801,660	F1057I	probably damaging	Het
Ifi213	A	T	1: 173,567,272		probably null	Het
Ighv1-20	A	T	12: 114,723,851	V91E	probably damaging	Het
Inhba	A	G	13: 16,026,786	E311G	probably damaging	Het
Irx3	G	T	8: 91,799,480		probably null	Het
Jag1	C	A	2: 137,084,995	C948F	probably damaging	Het
Kcna2	T	C	3: 107,105,309	I402T	possibly damaging	Het
Kcnh8	A	T	17: 52,977,816	Q938L	possibly damaging	Het
Lrsam1	ACC	AC	2: 32,945,858		probably null	Het
Macf1	T	C	4: 123,450,061	T2123A	probably benign	Het
Mdh1	A	T	11: 21,559,786	N196K	probably benign	Het
Msh6	G	A	17: 87,984,561	R248Q	possibly damaging	Het
Odf2l	G	T	3: 145,146,866	R457L	probably benign	Het
Olfr822	A	T	10: 130,075,029	L206F	probably damaging	Het
Pphln1	T	C	15: 93,488,975	V318A	possibly damaging	Het
Ppp1r12a	C	T	10: 108,240,112	T267I	probably damaging	Het
Pramef20	T	C	4: 144,377,157	D133G	probably benign	Het
Prpf8	A	C	11: 75,503,643	K1801N	possibly damaging	Het
Raf1	A	G	6: 115,626,706		probably null	Het
Rasal3	C	A	17: 32,396,669	L374F	probably damaging	Het
S1pr3	T	A	13: 51,419,647	V288D	probably damaging	Het
Setd7	G	A	3: 51,521,465	P315S	probably benign	Het
Slx4	C	T	16: 3,991,540	A364T	probably benign	Het
Sp7	G	A	15: 102,359,314	T19I	probably benign	Het
Tmem117	T	A	15: 95,094,513	D351E	possibly damaging	Het
Tmem45b	T	A	9: 31,428,044	D211V	possibly damaging	Het
Tns3	A	G	11: 8,451,092	S1069P	probably benign	Het
Tsnax	A	G	8: 125,015,762	I77V	probably benign	Het
Txndc5	G	A	13: 38,513,125	L79F	possibly damaging	Het
Ube2q1	A	G	3: 89,777,241	E14G	probably benign	Het
Vmn2r28	C	T	7: 5,487,944		probably null	Het
Vwde	A	T	6: 13,193,118	D407E	probably benign	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Zfp109	A	T	7: 24,228,621	C462*	probably null	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
R9581:Tlr9	UTSW	9	106224311	missense	probably damaging	1.00
R9689:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R9697:Tlr9	UTSW	9	106223524	nonsense	probably null
R9788:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGAGCAATCTCACCCATCTG -3'
(R):5'- CAGGCGGGTTAGGTTCTGAAAG -3'

Sequencing Primer
(F):5'- ACCCATCTGTCTCTGAAGTATAAC -3'
(R):5'- AGGTTCTGAAAGGCATTGGTG -3'

Posted On

2016-10-06