Mutagenetix > Incidental Mutation

Incidental Mutation 'R5472:Ppp1r12a'

433875

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r12a

Ensembl Gene

ENSMUSG00000019907

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 12A

Synonyms

1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e

MMRRC Submission

043033-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108162193-108284475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108240112 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 267 (T267I)

Ref Sequence

ENSEMBL: ENSMUSP00000151842 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263]

AlphaFold

Q9DBR7

Predicted Effect

probably damaging
Transcript: ENSMUST00000070663
AA Change: T267I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: T267I

Domain	Start	End	E-Value	Type
ANK	38	68	1.01e2	SMART
ANK	72	101	1.66e-6	SMART
ANK	105	134	6.36e-3	SMART
ANK	138	168	5.52e2	SMART
ANK	198	227	6.12e-5	SMART
ANK	231	260	5.16e-3	SMART
coiled coil region	333	354	N/A	INTRINSIC
low complexity region	385	402	N/A	INTRINSIC
low complexity region	469	480	N/A	INTRINSIC
low complexity region	517	531	N/A	INTRINSIC
low complexity region	564	578	N/A	INTRINSIC
low complexity region	596	610	N/A	INTRINSIC
low complexity region	626	656	N/A	INTRINSIC
PDB:2KJY\|A	657	712	5e-12	PDB
low complexity region	719	745	N/A	INTRINSIC
low complexity region	771	794	N/A	INTRINSIC
low complexity region	815	833	N/A	INTRINSIC
low complexity region	836	851	N/A	INTRINSIC
low complexity region	883	902	N/A	INTRINSIC
Pfam:PRKG1_interact	930	993	4.5e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000219263
AA Change: T267I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,513,429	N506S	probably benign	Het
BC067074	A	G	13: 113,319,169	D583G	probably benign	Het
Brinp3	A	T	1: 146,901,459	H548L	possibly damaging	Het
Cacna1c	A	G	6: 118,638,446	V1328A	possibly damaging	Het
Carmil1	C	T	13: 24,155,471	V47I	probably damaging	Het
Cdk2ap2	C	A	19: 4,098,048	T76K	probably benign	Het
Col16a1	T	C	4: 130,092,771		probably benign	Het
Cxcr4	C	A	1: 128,589,625	A100S	probably damaging	Het
Fancl	G	T	11: 26,469,677	C305F	probably damaging	Het
Gcnt2	T	C	13: 40,953,579	V308A	probably benign	Het
Gm11733	A	T	11: 117,484,496	I24L	unknown	Het
Gm765	A	T	6: 98,238,276	C129S	probably damaging	Het
Gm973	A	G	1: 59,628,287		probably null	Het
Gm996	T	C	2: 25,579,702	T66A	probably benign	Het
Heatr5b	A	T	17: 78,801,660	F1057I	probably damaging	Het
Ifi213	A	T	1: 173,567,272		probably null	Het
Ighv1-20	A	T	12: 114,723,851	V91E	probably damaging	Het
Inhba	A	G	13: 16,026,786	E311G	probably damaging	Het
Irx3	G	T	8: 91,799,480		probably null	Het
Jag1	C	A	2: 137,084,995	C948F	probably damaging	Het
Kcna2	T	C	3: 107,105,309	I402T	possibly damaging	Het
Kcnh8	A	T	17: 52,977,816	Q938L	possibly damaging	Het
Lrsam1	ACC	AC	2: 32,945,858		probably null	Het
Macf1	T	C	4: 123,450,061	T2123A	probably benign	Het
Mdh1	A	T	11: 21,559,786	N196K	probably benign	Het
Msh6	G	A	17: 87,984,561	R248Q	possibly damaging	Het
Odf2l	G	T	3: 145,146,866	R457L	probably benign	Het
Olfr822	A	T	10: 130,075,029	L206F	probably damaging	Het
Pphln1	T	C	15: 93,488,975	V318A	possibly damaging	Het
Pramef20	T	C	4: 144,377,157	D133G	probably benign	Het
Prpf8	A	C	11: 75,503,643	K1801N	possibly damaging	Het
Raf1	A	G	6: 115,626,706		probably null	Het
Rasal3	C	A	17: 32,396,669	L374F	probably damaging	Het
S1pr3	T	A	13: 51,419,647	V288D	probably damaging	Het
Setd7	G	A	3: 51,521,465	P315S	probably benign	Het
Slx4	C	T	16: 3,991,540	A364T	probably benign	Het
Sp7	G	A	15: 102,359,314	T19I	probably benign	Het
Tlr9	T	A	9: 106,224,313	C268S	probably damaging	Het
Tmem117	T	A	15: 95,094,513	D351E	possibly damaging	Het
Tmem45b	T	A	9: 31,428,044	D211V	possibly damaging	Het
Tns3	A	G	11: 8,451,092	S1069P	probably benign	Het
Tsnax	A	G	8: 125,015,762	I77V	probably benign	Het
Txndc5	G	A	13: 38,513,125	L79F	possibly damaging	Het
Ube2q1	A	G	3: 89,777,241	E14G	probably benign	Het
Vmn2r28	C	T	7: 5,487,944		probably null	Het
Vwde	A	T	6: 13,193,118	D407E	probably benign	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Zfp109	A	T	7: 24,228,621	C462*	probably null	Het

Other mutations in Ppp1r12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Ppp1r12a	APN	10	108198848	missense	probably damaging	1.00
IGL00727:Ppp1r12a	APN	10	108230473	missense	probably damaging	1.00
IGL00819:Ppp1r12a	APN	10	108240821	missense	probably damaging	0.98
IGL01538:Ppp1r12a	APN	10	108234021	missense	probably damaging	1.00
IGL02227:Ppp1r12a	APN	10	108269324	missense	probably damaging	1.00
IGL02957:Ppp1r12a	APN	10	108198918	missense	probably damaging	0.98
IGL03063:Ppp1r12a	APN	10	108261254	missense	probably damaging	1.00
IGL03260:Ppp1r12a	APN	10	108261245	missense	probably benign	0.10
R0049:Ppp1r12a	UTSW	10	108253332	missense	possibly damaging	0.63
R0268:Ppp1r12a	UTSW	10	108273381	intron	probably benign
R0826:Ppp1r12a	UTSW	10	108230553	missense	possibly damaging	0.46
R0839:Ppp1r12a	UTSW	10	108198861	missense	probably damaging	1.00
R1026:Ppp1r12a	UTSW	10	108251859	missense	probably benign	0.08
R1053:Ppp1r12a	UTSW	10	108262351	missense	probably damaging	1.00
R1376:Ppp1r12a	UTSW	10	108198918	missense	probably damaging	0.98
R1376:Ppp1r12a	UTSW	10	108198918	missense	probably damaging	0.98
R1511:Ppp1r12a	UTSW	10	108251859	missense	probably benign	0.08
R1616:Ppp1r12a	UTSW	10	108260867	missense	probably damaging	1.00
R1673:Ppp1r12a	UTSW	10	108249565	missense	probably damaging	0.96
R1866:Ppp1r12a	UTSW	10	108262431	missense	possibly damaging	0.85
R1901:Ppp1r12a	UTSW	10	108198891	missense	probably damaging	1.00
R1902:Ppp1r12a	UTSW	10	108198891	missense	probably damaging	1.00
R2233:Ppp1r12a	UTSW	10	108198919	missense	possibly damaging	0.83
R2234:Ppp1r12a	UTSW	10	108198919	missense	possibly damaging	0.83
R3760:Ppp1r12a	UTSW	10	108264734	missense	probably damaging	1.00
R3856:Ppp1r12a	UTSW	10	108253501	intron	probably benign
R3973:Ppp1r12a	UTSW	10	108253480	missense	probably benign	0.44
R3974:Ppp1r12a	UTSW	10	108253480	missense	probably benign	0.44
R3976:Ppp1r12a	UTSW	10	108253480	missense	probably benign	0.44
R4502:Ppp1r12a	UTSW	10	108249478	missense	probably benign	0.26
R4902:Ppp1r12a	UTSW	10	108230590	missense	probably damaging	1.00
R5092:Ppp1r12a	UTSW	10	108267402	critical splice acceptor site	probably null
R5224:Ppp1r12a	UTSW	10	108261025	missense	probably benign	0.37
R5353:Ppp1r12a	UTSW	10	108261216	splice site	probably null
R5428:Ppp1r12a	UTSW	10	108253347	missense	possibly damaging	0.76
R5510:Ppp1r12a	UTSW	10	108249627	missense	possibly damaging	0.82
R6217:Ppp1r12a	UTSW	10	108240184	splice site	probably null
R6274:Ppp1r12a	UTSW	10	108260890	missense	probably benign	0.00
R6431:Ppp1r12a	UTSW	10	108262420	missense	probably damaging	1.00
R6744:Ppp1r12a	UTSW	10	108230534	missense	probably damaging	1.00
R6838:Ppp1r12a	UTSW	10	108261276	missense	possibly damaging	0.76
R6865:Ppp1r12a	UTSW	10	108262381	nonsense	probably null
R6993:Ppp1r12a	UTSW	10	108240837	missense	probably benign	0.18
R7565:Ppp1r12a	UTSW	10	108268640	missense	probably benign	0.21
R8153:Ppp1r12a	UTSW	10	108162442	missense	probably damaging	0.98
R8174:Ppp1r12a	UTSW	10	108271737	missense	probably benign	0.26
R8407:Ppp1r12a	UTSW	10	108240181	critical splice donor site	probably null
R8422:Ppp1r12a	UTSW	10	108241181	missense	probably benign
R8716:Ppp1r12a	UTSW	10	108260888	missense	probably damaging	1.00
R9090:Ppp1r12a	UTSW	10	108262363	missense	probably damaging	1.00
R9179:Ppp1r12a	UTSW	10	108251921	missense	probably damaging	1.00
R9271:Ppp1r12a	UTSW	10	108262363	missense	probably damaging	1.00
R9396:Ppp1r12a	UTSW	10	108264710	missense	probably damaging	1.00
R9683:Ppp1r12a	UTSW	10	108260886	missense	possibly damaging	0.78
X0027:Ppp1r12a	UTSW	10	108214423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCTTGGAGTCCTGTATAGTC -3'
(R):5'- GCCCACTGTCATTGTGTTTG -3'

Sequencing Primer
(F):5'- CTACGAGAGACCCTGTCTGTAAG -3'
(R):5'- CACTGTCATTGTGTTTGATTACGAAG -3'

Posted On

2016-10-06