Mutagenetix > Incidental Mutation

Incidental Mutation 'R5472:Tns3'

433877

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

043033-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.371) question?

Stock #

R5472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8451092 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1069 (S1069P)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably benign
Transcript: ENSMUST00000020695
AA Change: S1069P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: S1069P

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129074

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,513,429	N506S	probably benign	Het
BC067074	A	G	13: 113,319,169	D583G	probably benign	Het
Brinp3	A	T	1: 146,901,459	H548L	possibly damaging	Het
Cacna1c	A	G	6: 118,638,446	V1328A	possibly damaging	Het
Carmil1	C	T	13: 24,155,471	V47I	probably damaging	Het
Cdk2ap2	C	A	19: 4,098,048	T76K	probably benign	Het
Col16a1	T	C	4: 130,092,771		probably benign	Het
Cxcr4	C	A	1: 128,589,625	A100S	probably damaging	Het
Fancl	G	T	11: 26,469,677	C305F	probably damaging	Het
Gcnt2	T	C	13: 40,953,579	V308A	probably benign	Het
Gm11733	A	T	11: 117,484,496	I24L	unknown	Het
Gm765	A	T	6: 98,238,276	C129S	probably damaging	Het
Gm973	A	G	1: 59,628,287		probably null	Het
Gm996	T	C	2: 25,579,702	T66A	probably benign	Het
Heatr5b	A	T	17: 78,801,660	F1057I	probably damaging	Het
Ifi213	A	T	1: 173,567,272		probably null	Het
Ighv1-20	A	T	12: 114,723,851	V91E	probably damaging	Het
Inhba	A	G	13: 16,026,786	E311G	probably damaging	Het
Irx3	G	T	8: 91,799,480		probably null	Het
Jag1	C	A	2: 137,084,995	C948F	probably damaging	Het
Kcna2	T	C	3: 107,105,309	I402T	possibly damaging	Het
Kcnh8	A	T	17: 52,977,816	Q938L	possibly damaging	Het
Lrsam1	ACC	AC	2: 32,945,858		probably null	Het
Macf1	T	C	4: 123,450,061	T2123A	probably benign	Het
Mdh1	A	T	11: 21,559,786	N196K	probably benign	Het
Msh6	G	A	17: 87,984,561	R248Q	possibly damaging	Het
Odf2l	G	T	3: 145,146,866	R457L	probably benign	Het
Olfr822	A	T	10: 130,075,029	L206F	probably damaging	Het
Pphln1	T	C	15: 93,488,975	V318A	possibly damaging	Het
Ppp1r12a	C	T	10: 108,240,112	T267I	probably damaging	Het
Pramef20	T	C	4: 144,377,157	D133G	probably benign	Het
Prpf8	A	C	11: 75,503,643	K1801N	possibly damaging	Het
Raf1	A	G	6: 115,626,706		probably null	Het
Rasal3	C	A	17: 32,396,669	L374F	probably damaging	Het
S1pr3	T	A	13: 51,419,647	V288D	probably damaging	Het
Setd7	G	A	3: 51,521,465	P315S	probably benign	Het
Slx4	C	T	16: 3,991,540	A364T	probably benign	Het
Sp7	G	A	15: 102,359,314	T19I	probably benign	Het
Tlr9	T	A	9: 106,224,313	C268S	probably damaging	Het
Tmem117	T	A	15: 95,094,513	D351E	possibly damaging	Het
Tmem45b	T	A	9: 31,428,044	D211V	possibly damaging	Het
Tsnax	A	G	8: 125,015,762	I77V	probably benign	Het
Txndc5	G	A	13: 38,513,125	L79F	possibly damaging	Het
Ube2q1	A	G	3: 89,777,241	E14G	probably benign	Het
Vmn2r28	C	T	7: 5,487,944		probably null	Het
Vwde	A	T	6: 13,193,118	D407E	probably benign	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Zfp109	A	T	7: 24,228,621	C462*	probably null	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R8790:Tns3	UTSW	11	8518273	missense	probably damaging	0.99
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9374:Tns3	UTSW	11	8492606	missense	probably damaging	1.00
R9476:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTCTGAAGGCTTGCAGAAGTC -3'
(R):5'- GGGCAGCCAAACCTTCTTAG -3'

Sequencing Primer
(F):5'- CATTCGGGAAGGGGATGCTC -3'
(R):5'- TTAGGTTTCAACACAGTAACCACAG -3'

Posted On

2016-10-06