Incidental Mutation 'R5472:Tns3'
ID433877
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Nametensin 3
SynonymsTEM6, F830010I22Rik, Tens1
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location8431652-8664535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8451092 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1069 (S1069P)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
Predicted Effect probably benign
Transcript: ENSMUST00000020695
AA Change: S1069P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: S1069P

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129074
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8451066 missense probably benign 0.42
IGL00822:Tns3 APN 11 8443976 missense probably damaging 0.99
IGL01075:Tns3 APN 11 8478399 missense probably benign 0.45
IGL01286:Tns3 APN 11 8492617 missense probably benign 0.01
IGL01680:Tns3 APN 11 8548937 missense probably damaging 1.00
IGL01687:Tns3 APN 11 8492798 missense probably damaging 1.00
IGL01734:Tns3 APN 11 8519192 splice site probably benign
IGL01844:Tns3 APN 11 8437177 missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8548992 nonsense probably null
IGL02137:Tns3 APN 11 8492578 missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8434531 missense probably damaging 1.00
IGL02623:Tns3 APN 11 8437141 missense probably damaging 1.00
IGL02697:Tns3 APN 11 8492346 missense probably benign 0.00
IGL02829:Tns3 APN 11 8519564 missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8492149 missense probably benign 0.38
R0020:Tns3 UTSW 11 8545227 critical splice donor site probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0064:Tns3 UTSW 11 8435856 nonsense probably null
R0370:Tns3 UTSW 11 8445730 missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8445703 missense probably benign 0.07
R0410:Tns3 UTSW 11 8435852 missense probably benign 0.02
R0496:Tns3 UTSW 11 8547262 splice site probably benign
R0562:Tns3 UTSW 11 8493262 missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8493121 missense probably benign 0.04
R0736:Tns3 UTSW 11 8519474 missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8493302 missense probably damaging 1.00
R1367:Tns3 UTSW 11 8448704 missense probably benign 0.01
R1386:Tns3 UTSW 11 8518261 missense probably benign 0.02
R1975:Tns3 UTSW 11 8435738 missense probably benign 0.04
R2205:Tns3 UTSW 11 8531719 missense probably damaging 1.00
R2319:Tns3 UTSW 11 8541200 missense probably damaging 1.00
R2830:Tns3 UTSW 11 8435870 missense probably damaging 1.00
R3720:Tns3 UTSW 11 8492999 missense probably damaging 1.00
R3765:Tns3 UTSW 11 8451133 missense probably benign 0.00
R3817:Tns3 UTSW 11 8434619 missense probably damaging 1.00
R4058:Tns3 UTSW 11 8492275 missense probably damaging 1.00
R4599:Tns3 UTSW 11 8531747 missense probably damaging 1.00
R4631:Tns3 UTSW 11 8451119 missense probably benign 0.30
R4731:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4732:Tns3 UTSW 11 8450986 missense probably benign 0.28
R4733:Tns3 UTSW 11 8450986 missense probably benign 0.28
R5749:Tns3 UTSW 11 8451177 missense probably benign 0.01
R5807:Tns3 UTSW 11 8493211 missense probably damaging 1.00
R5844:Tns3 UTSW 11 8434580 missense probably damaging 1.00
R5942:Tns3 UTSW 11 8435860 missense probably damaging 1.00
R5982:Tns3 UTSW 11 8492245 missense probably damaging 0.99
R6025:Tns3 UTSW 11 8492578 missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8492987 missense probably damaging 1.00
R6322:Tns3 UTSW 11 8492147 missense probably benign 0.01
R6536:Tns3 UTSW 11 8434531 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549057 missense probably damaging 1.00
R6577:Tns3 UTSW 11 8549058 missense probably damaging 1.00
R6864:Tns3 UTSW 11 8493196 missense probably damaging 1.00
R6897:Tns3 UTSW 11 8531743 missense probably damaging 1.00
R7108:Tns3 UTSW 11 8437251 missense probably benign 0.00
R7443:Tns3 UTSW 11 8451442 missense probably benign 0.01
R7459:Tns3 UTSW 11 8492793 missense probably benign 0.16
R7474:Tns3 UTSW 11 8530894 missense probably damaging 1.00
R7576:Tns3 UTSW 11 8541192 missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8492701 missense probably benign 0.01
R8055:Tns3 UTSW 11 8545343 missense probably damaging 1.00
R8057:Tns3 UTSW 11 8492773 missense probably benign
R8077:Tns3 UTSW 11 8445667 missense probably damaging 1.00
T0975:Tns3 UTSW 11 8451146 missense probably benign 0.00
T0975:Tns3 UTSW 11 8479518 missense probably benign
T0975:Tns3 UTSW 11 8549100 start gained probably benign
X0005:Tns3 UTSW 11 8451224 missense probably benign 0.00
X0005:Tns3 UTSW 11 8479518 missense probably benign
Z1177:Tns3 UTSW 11 8451014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCTGAAGGCTTGCAGAAGTC -3'
(R):5'- GGGCAGCCAAACCTTCTTAG -3'

Sequencing Primer
(F):5'- CATTCGGGAAGGGGATGCTC -3'
(R):5'- TTAGGTTTCAACACAGTAACCACAG -3'
Posted On2016-10-06