Incidental Mutation 'R5472:Gcnt2'
ID 433887
Institutional Source Beutler Lab
Gene Symbol Gcnt2
Ensembl Gene ENSMUSG00000021360
Gene Name glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms 5330430K10Rik, IGnTB, IGnT, IGnTA, IGnTC
MMRRC Submission 043033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R5472 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 41013417-41114368 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41107055 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 308 (V308A)
Ref Sequence ENSEMBL: ENSMUSP00000066467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000223570] [ENSMUST00000225759]
AlphaFold P97402
Predicted Effect probably benign
Transcript: ENSMUST00000067778
AA Change: V308A

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360
AA Change: V308A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Branch 95 357 4.2e-58 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069958
AA Change: V308A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360
AA Change: V308A

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Branch 95 357 8.4e-60 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110191
AA Change: V308A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360
AA Change: V308A

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Branch 95 357 5.2e-61 PFAM
low complexity region 377 386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153685
Predicted Effect probably benign
Transcript: ENSMUST00000223570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223891
Predicted Effect probably benign
Transcript: ENSMUST00000225759
AA Change: V308A

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225996
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ajm1 T C 2: 25,469,714 (GRCm39) T66A probably benign Het
Akap11 T C 14: 78,750,869 (GRCm39) N506S probably benign Het
Brinp3 A T 1: 146,777,197 (GRCm39) H548L possibly damaging Het
Cacna1c A G 6: 118,615,407 (GRCm39) V1328A possibly damaging Het
Carmil1 C T 13: 24,339,454 (GRCm39) V47I probably damaging Het
Cdk2ap2 C A 19: 4,148,048 (GRCm39) T76K probably benign Het
Col16a1 T C 4: 129,986,564 (GRCm39) probably benign Het
Cspg4b A G 13: 113,455,703 (GRCm39) D583G probably benign Het
Cxcr4 C A 1: 128,517,362 (GRCm39) A100S probably damaging Het
Fancl G T 11: 26,419,677 (GRCm39) C305F probably damaging Het
Gm11733 A T 11: 117,375,322 (GRCm39) I24L unknown Het
Gm973 A G 1: 59,667,446 (GRCm39) probably null Het
Heatr5b A T 17: 79,109,089 (GRCm39) F1057I probably damaging Het
Ifi213 A T 1: 173,394,838 (GRCm39) probably null Het
Ighv1-20 A T 12: 114,687,471 (GRCm39) V91E probably damaging Het
Inhba A G 13: 16,201,371 (GRCm39) E311G probably damaging Het
Irx3 G T 8: 92,526,108 (GRCm39) probably null Het
Jag1 C A 2: 136,926,915 (GRCm39) C948F probably damaging Het
Kcna2 T C 3: 107,012,625 (GRCm39) I402T possibly damaging Het
Kcnh8 A T 17: 53,284,844 (GRCm39) Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,835,870 (GRCm39) probably null Het
Macf1 T C 4: 123,343,854 (GRCm39) T2123A probably benign Het
Mdfic2 A T 6: 98,215,237 (GRCm39) C129S probably damaging Het
Mdh1 A T 11: 21,509,786 (GRCm39) N196K probably benign Het
Msh6 G A 17: 88,291,989 (GRCm39) R248Q possibly damaging Het
Odf2l G T 3: 144,852,627 (GRCm39) R457L probably benign Het
Or6c69c A T 10: 129,910,898 (GRCm39) L206F probably damaging Het
Pphln1 T C 15: 93,386,856 (GRCm39) V318A possibly damaging Het
Ppp1r12a C T 10: 108,075,973 (GRCm39) T267I probably damaging Het
Pramel15 T C 4: 144,103,727 (GRCm39) D133G probably benign Het
Prpf8 A C 11: 75,394,469 (GRCm39) K1801N possibly damaging Het
Raf1 A G 6: 115,603,667 (GRCm39) probably null Het
Rasal3 C A 17: 32,615,643 (GRCm39) L374F probably damaging Het
S1pr3 T A 13: 51,573,683 (GRCm39) V288D probably damaging Het
Setd7 G A 3: 51,428,886 (GRCm39) P315S probably benign Het
Slx4 C T 16: 3,809,404 (GRCm39) A364T probably benign Het
Sp7 G A 15: 102,267,749 (GRCm39) T19I probably benign Het
Tlr9 T A 9: 106,101,512 (GRCm39) C268S probably damaging Het
Tmem117 T A 15: 94,992,394 (GRCm39) D351E possibly damaging Het
Tmem45b T A 9: 31,339,340 (GRCm39) D211V possibly damaging Het
Tns3 A G 11: 8,401,092 (GRCm39) S1069P probably benign Het
Tsnax A G 8: 125,742,501 (GRCm39) I77V probably benign Het
Txndc5 G A 13: 38,697,101 (GRCm39) L79F possibly damaging Het
Ube2q1 A G 3: 89,684,548 (GRCm39) E14G probably benign Het
Vmn2r28 C T 7: 5,490,943 (GRCm39) probably null Het
Vwde A T 6: 13,193,117 (GRCm39) D407E probably benign Het
Wdr35 T A 12: 9,066,619 (GRCm39) M749K probably benign Het
Zfp109 A T 7: 23,928,046 (GRCm39) C462* probably null Het
Other mutations in Gcnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Gcnt2 APN 13 41,041,339 (GRCm39) missense probably benign 0.06
IGL01693:Gcnt2 APN 13 41,041,549 (GRCm39) missense probably benign
IGL02506:Gcnt2 APN 13 41,040,856 (GRCm39) missense probably benign 0.02
IGL03184:Gcnt2 APN 13 41,041,660 (GRCm39) missense probably benign 0.01
BB001:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
BB011:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
PIT4472001:Gcnt2 UTSW 13 41,071,413 (GRCm39) missense probably benign 0.39
R0358:Gcnt2 UTSW 13 41,014,329 (GRCm39) missense probably damaging 0.99
R0734:Gcnt2 UTSW 13 41,013,997 (GRCm39) missense probably benign 0.00
R1863:Gcnt2 UTSW 13 41,014,577 (GRCm39) missense possibly damaging 0.95
R3103:Gcnt2 UTSW 13 41,072,082 (GRCm39) missense probably benign 0.00
R3156:Gcnt2 UTSW 13 41,014,654 (GRCm39) missense probably benign 0.36
R3893:Gcnt2 UTSW 13 41,013,922 (GRCm39) missense probably benign 0.14
R4134:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4135:Gcnt2 UTSW 13 41,041,283 (GRCm39) missense probably damaging 1.00
R4279:Gcnt2 UTSW 13 41,041,666 (GRCm39) missense probably benign 0.17
R4422:Gcnt2 UTSW 13 41,014,001 (GRCm39) nonsense probably null
R4599:Gcnt2 UTSW 13 41,040,966 (GRCm39) missense probably benign
R4618:Gcnt2 UTSW 13 41,111,670 (GRCm39) nonsense probably null
R4908:Gcnt2 UTSW 13 41,014,210 (GRCm39) missense probably damaging 1.00
R5123:Gcnt2 UTSW 13 41,071,831 (GRCm39) missense probably damaging 0.99
R5291:Gcnt2 UTSW 13 41,072,268 (GRCm39) missense probably damaging 1.00
R5437:Gcnt2 UTSW 13 41,014,652 (GRCm39) missense probably damaging 1.00
R5463:Gcnt2 UTSW 13 41,071,650 (GRCm39) missense possibly damaging 0.80
R5471:Gcnt2 UTSW 13 41,014,195 (GRCm39) missense probably damaging 1.00
R5493:Gcnt2 UTSW 13 41,107,076 (GRCm39) missense possibly damaging 0.70
R5586:Gcnt2 UTSW 13 41,014,429 (GRCm39) missense probably damaging 1.00
R5695:Gcnt2 UTSW 13 41,071,675 (GRCm39) missense probably benign 0.03
R6244:Gcnt2 UTSW 13 41,014,717 (GRCm39) missense probably damaging 1.00
R6293:Gcnt2 UTSW 13 41,072,173 (GRCm39) missense probably damaging 1.00
R7036:Gcnt2 UTSW 13 41,041,032 (GRCm39) frame shift probably null
R7077:Gcnt2 UTSW 13 41,013,896 (GRCm39) missense probably benign
R7432:Gcnt2 UTSW 13 41,040,688 (GRCm39) intron probably benign
R7474:Gcnt2 UTSW 13 41,111,733 (GRCm39) missense probably damaging 1.00
R7508:Gcnt2 UTSW 13 41,041,157 (GRCm39) missense probably benign 0.02
R7599:Gcnt2 UTSW 13 41,014,343 (GRCm39) nonsense probably null
R7678:Gcnt2 UTSW 13 41,107,195 (GRCm39) missense probably benign 0.01
R7806:Gcnt2 UTSW 13 41,071,717 (GRCm39) missense probably damaging 1.00
R7808:Gcnt2 UTSW 13 41,014,338 (GRCm39) missense possibly damaging 0.81
R7909:Gcnt2 UTSW 13 41,013,926 (GRCm39) missense probably benign 0.00
R7924:Gcnt2 UTSW 13 41,072,040 (GRCm39) nonsense probably null
R8110:Gcnt2 UTSW 13 41,071,198 (GRCm39) start gained probably benign
R8287:Gcnt2 UTSW 13 41,014,108 (GRCm39) missense probably damaging 1.00
R8782:Gcnt2 UTSW 13 41,072,229 (GRCm39) missense probably damaging 0.98
R8956:Gcnt2 UTSW 13 41,041,204 (GRCm39) missense probably benign 0.30
R9225:Gcnt2 UTSW 13 41,014,336 (GRCm39) missense probably damaging 1.00
R9357:Gcnt2 UTSW 13 41,041,732 (GRCm39) missense possibly damaging 0.92
Z1088:Gcnt2 UTSW 13 41,072,115 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGATGCGTGGAGACTGC -3'
(R):5'- AGCACAAGAACCTCTTTTACTGAG -3'

Sequencing Primer
(F):5'- GCTCAACTAGGACAGTGATGCTTC -3'
(R):5'- ACAAGAACCTCTTTTACTGAGTTTAC -3'
Posted On 2016-10-06