Incidental Mutation 'R5472:S1pr3'
ID433888
Institutional Source Beutler Lab
Gene Symbol S1pr3
Ensembl Gene ENSMUSG00000067586
Gene Namesphingosine-1-phosphate receptor 3
SynonymsLPb3, Edg3, S1P3
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location51408639-51422797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51419647 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 288 (V288D)
Ref Sequence ENSEMBL: ENSMUSP00000085293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087978]
Predicted Effect probably damaging
Transcript: ENSMUST00000087978
AA Change: V288D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085293
Gene: ENSMUSG00000067586
AA Change: V288D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 51 313 1.8e-12 PFAM
Pfam:7tm_1 57 298 8.8e-39 PFAM
low complexity region 334 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222417
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor 1 family. The encoded protein is a receptor for the lysophospholipid sphingosine 1-phosphate. The gene product functions in endothelial cells and is involved in vascular and heart development. The gene product mediates HDL and HDL-associated lysophospholipid-induced vasorelaxation, and it coordinates with other lysophospholipid receptors in the process of angiogenesis. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype although litter sizes are reduced. Susceptibility to pulmonary edema is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in S1pr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:S1pr3 APN 13 51419512 missense probably damaging 1.00
IGL01997:S1pr3 APN 13 51419715 missense probably damaging 1.00
IGL02270:S1pr3 APN 13 51419056 missense probably benign 0.03
R0242:S1pr3 UTSW 13 51418902 missense probably benign 0.00
R0242:S1pr3 UTSW 13 51418902 missense probably benign 0.00
R0584:S1pr3 UTSW 13 51419661 missense probably benign 0.00
R1869:S1pr3 UTSW 13 51419916 missense probably benign 0.01
R1870:S1pr3 UTSW 13 51419916 missense probably benign 0.01
R2338:S1pr3 UTSW 13 51419578 missense possibly damaging 0.76
R6006:S1pr3 UTSW 13 51419695 missense probably damaging 1.00
R6345:S1pr3 UTSW 13 51419031 missense probably damaging 1.00
R6345:S1pr3 UTSW 13 51419032 missense probably damaging 1.00
R6702:S1pr3 UTSW 13 51419439 missense probably damaging 1.00
R6703:S1pr3 UTSW 13 51419439 missense probably damaging 1.00
R8066:S1pr3 UTSW 13 51419919 makesense probably null
R8330:S1pr3 UTSW 13 51419137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTACTGCCTGGTCAAGTCC -3'
(R):5'- CTTCCTTGACCTTCGGAGAGTG -3'

Sequencing Primer
(F):5'- TGGTCAAGTCCAGCAGCC -3'
(R):5'- ACCTTCGGAGAGTGGCTGC -3'
Posted On2016-10-06