Mutagenetix > Incidental Mutation

Incidental Mutation 'R5472:Slx4'

433894

Institutional Source

Beutler Lab

Gene Symbol

Slx4

Ensembl Gene

ENSMUSG00000039738

Gene Name

SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)

Synonyms

Btbd12, D16Bwg1016e

MMRRC Submission

043033-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5472 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3979105-4003770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3991540 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 364 (A364T)

Ref Sequence

ENSEMBL: ENSMUSP00000038871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040790]

AlphaFold

Q6P1D7

Predicted Effect

probably benign
Transcript: ENSMUST00000040790
AA Change: A364T

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: A364T

Domain	Start	End	E-Value	Type
low complexity region	400	413	N/A	INTRINSIC
BTB	506	609	6.15e-7	SMART
low complexity region	651	667	N/A	INTRINSIC
low complexity region	833	849	N/A	INTRINSIC
low complexity region	857	875	N/A	INTRINSIC
low complexity region	1176	1192	N/A	INTRINSIC
low complexity region	1437	1461	N/A	INTRINSIC
Pfam:Slx4	1484	1541	3e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000146569

SMART Domains

Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

Domain	Start	End	E-Value	Type
Pfam:BTB	6	102	6.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156542

Predicted Effect

probably benign
Transcript: ENSMUST00000165830

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,513,429	N506S	probably benign	Het
BC067074	A	G	13: 113,319,169	D583G	probably benign	Het
Brinp3	A	T	1: 146,901,459	H548L	possibly damaging	Het
Cacna1c	A	G	6: 118,638,446	V1328A	possibly damaging	Het
Carmil1	C	T	13: 24,155,471	V47I	probably damaging	Het
Cdk2ap2	C	A	19: 4,098,048	T76K	probably benign	Het
Col16a1	T	C	4: 130,092,771		probably benign	Het
Cxcr4	C	A	1: 128,589,625	A100S	probably damaging	Het
Fancl	G	T	11: 26,469,677	C305F	probably damaging	Het
Gcnt2	T	C	13: 40,953,579	V308A	probably benign	Het
Gm11733	A	T	11: 117,484,496	I24L	unknown	Het
Gm765	A	T	6: 98,238,276	C129S	probably damaging	Het
Gm973	A	G	1: 59,628,287		probably null	Het
Gm996	T	C	2: 25,579,702	T66A	probably benign	Het
Heatr5b	A	T	17: 78,801,660	F1057I	probably damaging	Het
Ifi213	A	T	1: 173,567,272		probably null	Het
Ighv1-20	A	T	12: 114,723,851	V91E	probably damaging	Het
Inhba	A	G	13: 16,026,786	E311G	probably damaging	Het
Irx3	G	T	8: 91,799,480		probably null	Het
Jag1	C	A	2: 137,084,995	C948F	probably damaging	Het
Kcna2	T	C	3: 107,105,309	I402T	possibly damaging	Het
Kcnh8	A	T	17: 52,977,816	Q938L	possibly damaging	Het
Lrsam1	ACC	AC	2: 32,945,858		probably null	Het
Macf1	T	C	4: 123,450,061	T2123A	probably benign	Het
Mdh1	A	T	11: 21,559,786	N196K	probably benign	Het
Msh6	G	A	17: 87,984,561	R248Q	possibly damaging	Het
Odf2l	G	T	3: 145,146,866	R457L	probably benign	Het
Olfr822	A	T	10: 130,075,029	L206F	probably damaging	Het
Pphln1	T	C	15: 93,488,975	V318A	possibly damaging	Het
Ppp1r12a	C	T	10: 108,240,112	T267I	probably damaging	Het
Pramef20	T	C	4: 144,377,157	D133G	probably benign	Het
Prpf8	A	C	11: 75,503,643	K1801N	possibly damaging	Het
Raf1	A	G	6: 115,626,706		probably null	Het
Rasal3	C	A	17: 32,396,669	L374F	probably damaging	Het
S1pr3	T	A	13: 51,419,647	V288D	probably damaging	Het
Setd7	G	A	3: 51,521,465	P315S	probably benign	Het
Sp7	G	A	15: 102,359,314	T19I	probably benign	Het
Tlr9	T	A	9: 106,224,313	C268S	probably damaging	Het
Tmem117	T	A	15: 95,094,513	D351E	possibly damaging	Het
Tmem45b	T	A	9: 31,428,044	D211V	possibly damaging	Het
Tns3	A	G	11: 8,451,092	S1069P	probably benign	Het
Tsnax	A	G	8: 125,015,762	I77V	probably benign	Het
Txndc5	G	A	13: 38,513,125	L79F	possibly damaging	Het
Ube2q1	A	G	3: 89,777,241	E14G	probably benign	Het
Vmn2r28	C	T	7: 5,487,944		probably null	Het
Vwde	A	T	6: 13,193,118	D407E	probably benign	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Zfp109	A	T	7: 24,228,621	C462*	probably null	Het

Other mutations in Slx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Slx4	APN	16	3990888	missense	probably benign	0.17
IGL01767:Slx4	APN	16	3990248	missense	probably benign	0.01
IGL02525:Slx4	APN	16	3980597	missense	probably damaging	1.00
slim	UTSW	16	3990910	nonsense	probably null
R0033:Slx4	UTSW	16	3988000	missense	probably benign	0.08
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0070:Slx4	UTSW	16	3988016	missense	possibly damaging	0.71
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0242:Slx4	UTSW	16	3986952	missense	probably damaging	0.99
R0363:Slx4	UTSW	16	3980089	missense	probably damaging	1.00
R0433:Slx4	UTSW	16	3986018	missense	probably benign	0.01
R0993:Slx4	UTSW	16	3985825	missense	probably benign	0.00
R1083:Slx4	UTSW	16	3990910	nonsense	probably null
R1373:Slx4	UTSW	16	3985510	missense	probably benign	0.02
R1710:Slx4	UTSW	16	3999158	missense	probably benign	0.15
R1712:Slx4	UTSW	16	3991594	missense	probably damaging	0.99
R1874:Slx4	UTSW	16	3986848	missense	probably benign	0.25
R1937:Slx4	UTSW	16	3987166	makesense	probably null
R2008:Slx4	UTSW	16	3979921	missense	probably damaging	1.00
R2156:Slx4	UTSW	16	3986359	missense	probably benign	0.00
R2427:Slx4	UTSW	16	3988987	missense	probably damaging	0.99
R3765:Slx4	UTSW	16	3980986	missense	probably damaging	1.00
R3890:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R3891:Slx4	UTSW	16	3979909	missense	probably damaging	1.00
R4465:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4467:Slx4	UTSW	16	3989055	missense	possibly damaging	0.82
R4497:Slx4	UTSW	16	3994909	missense	probably damaging	1.00
R4882:Slx4	UTSW	16	3980996	critical splice acceptor site	probably null
R5119:Slx4	UTSW	16	4001199	missense	possibly damaging	0.89
R5384:Slx4	UTSW	16	3990805	missense	probably damaging	1.00
R5578:Slx4	UTSW	16	3986862	missense	probably damaging	1.00
R5582:Slx4	UTSW	16	3985788	missense	possibly damaging	0.93
R5696:Slx4	UTSW	16	3979967	missense	probably damaging	1.00
R5827:Slx4	UTSW	16	4001284	missense	possibly damaging	0.94
R5964:Slx4	UTSW	16	4000951	critical splice donor site	probably null
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6032:Slx4	UTSW	16	3980157	missense	probably damaging	1.00
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6039:Slx4	UTSW	16	3986047	missense	possibly damaging	0.82
R6345:Slx4	UTSW	16	3990850	missense	probably benign	0.06
R6612:Slx4	UTSW	16	3985276	missense	probably damaging	0.99
R6979:Slx4	UTSW	16	3985015	missense	probably damaging	0.96
R6989:Slx4	UTSW	16	3995838	missense	probably damaging	1.00
R7171:Slx4	UTSW	16	3990786	missense	probably benign
R7214:Slx4	UTSW	16	3988980	missense	probably benign	0.18
R7354:Slx4	UTSW	16	3987099	missense	probably benign	0.28
R7490:Slx4	UTSW	16	3980131	missense	possibly damaging	0.91
R7545:Slx4	UTSW	16	3999300	missense	probably benign	0.11
R7547:Slx4	UTSW	16	3985572	missense	probably benign	0.05
R7790:Slx4	UTSW	16	3986982	missense	probably benign	0.03
R8119:Slx4	UTSW	16	3985272	nonsense	probably null
R8815:Slx4	UTSW	16	3985594	missense	probably benign	0.26
R8955:Slx4	UTSW	16	3990247	missense	probably benign
R9205:Slx4	UTSW	16	3988063	missense	possibly damaging	0.74
R9321:Slx4	UTSW	16	3986790	missense	probably benign	0.06
R9364:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9544:Slx4	UTSW	16	3980053	missense	probably damaging	0.97
R9554:Slx4	UTSW	16	3987956	missense	probably benign	0.00
R9632:Slx4	UTSW	16	3986105	missense	probably benign	0.00
R9665:Slx4	UTSW	16	3989026	missense	probably benign	0.28
R9718:Slx4	UTSW	16	3986464	missense	possibly damaging	0.73
R9772:Slx4	UTSW	16	4000985	missense

Predicted Primers

PCR Primer
(F):5'- GCTACTAAGTTGCCACAGAGAC -3'
(R):5'- GACAGATTGAAGATCGTGTTGCC -3'

Sequencing Primer
(F):5'- TTGCCACAGAGACAATGCG -3'
(R):5'- GAAGATCGTGTTGCCCAGCTTC -3'

Posted On

2016-10-06