Mutagenetix > Incidental Mutation

Incidental Mutation 'R5472:Rasal3'

433895

Institutional Source

Beutler Lab

Gene Symbol

Rasal3

Ensembl Gene

ENSMUSG00000052142

Gene Name

RAS protein activator like 3

Synonyms

A430107D22Rik

MMRRC Submission

043033-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R5472 (G1)

Quality Score

150

Status

Not validated

Chromosome

Chromosomal Location

32390659-32403583 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32396669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 374 (L374F)

Ref Sequence

ENSEMBL: ENSMUSP00000118738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063824] [ENSMUST00000135618] [ENSMUST00000136375] [ENSMUST00000137458]

AlphaFold

Q8C2K5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063824
AA Change: L396F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000064084
Gene: ENSMUSG00000052142
AA Change: L396F

Domain	Start	End	E-Value	Type
low complexity region	57	72	N/A	INTRINSIC
low complexity region	120	137	N/A	INTRINSIC
PH	165	323	3.94e0	SMART
Blast:RasGAP	354	381	9e-8	BLAST
low complexity region	385	402	N/A	INTRINSIC
RasGAP	433	755	2.03e-81	SMART
low complexity region	826	839	N/A	INTRINSIC
coiled coil region	932	1013	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134723

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135560

Predicted Effect

probably damaging
Transcript: ENSMUST00000135618
AA Change: L374F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116107
Gene: ENSMUSG00000052142
AA Change: L374F

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
PH	143	301	3.94e0	SMART
Blast:RasGAP	332	359	9e-8	BLAST
low complexity region	363	380	N/A	INTRINSIC
RasGAP	411	733	2.03e-81	SMART
low complexity region	804	817	N/A	INTRINSIC
coiled coil region	910	991	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135968

Predicted Effect

probably damaging
Transcript: ENSMUST00000136375
AA Change: L374F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118738
Gene: ENSMUSG00000052142
AA Change: L374F

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	98	115	N/A	INTRINSIC
PH	143	301	3.94e0	SMART
Blast:RasGAP	332	359	7e-8	BLAST
low complexity region	363	380	N/A	INTRINSIC
Pfam:RasGAP	483	579	6.4e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000137458
AA Change: L398F

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000123141
Gene: ENSMUSG00000052142
AA Change: L398F

Domain	Start	End	E-Value	Type
low complexity region	35	50	N/A	INTRINSIC
low complexity region	119	140	N/A	INTRINSIC
PH	167	325	3.94e0	SMART
Blast:RasGAP	356	383	9e-8	BLAST
low complexity region	387	404	N/A	INTRINSIC
RasGAP	435	757	2.03e-81	SMART
low complexity region	828	841	N/A	INTRINSIC
coiled coil region	934	1015	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142203

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143808

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.3%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the Ras GTPase-activating proteins (RasGAP) family and encodes a protein with pleckstrin homology (PH), C2, and Ras GTPase-activation protein (RasGAP) domains. This protein is localized near or at the plasma membrane when expressed exogenously. Reduced expression of this gene in some cell lines resulted in increased levels of the active form of Ras (Ras-GTP), suggesting that this gene may play a role in negatively regulating the Ras signaling pathway. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced NT T cells in the liver, increased granulocytes in the bone marrow and decreased susceptibility to alpha-GalCer-induced liver injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,513,429	N506S	probably benign	Het
BC067074	A	G	13: 113,319,169	D583G	probably benign	Het
Brinp3	A	T	1: 146,901,459	H548L	possibly damaging	Het
Cacna1c	A	G	6: 118,638,446	V1328A	possibly damaging	Het
Carmil1	C	T	13: 24,155,471	V47I	probably damaging	Het
Cdk2ap2	C	A	19: 4,098,048	T76K	probably benign	Het
Col16a1	T	C	4: 130,092,771		probably benign	Het
Cxcr4	C	A	1: 128,589,625	A100S	probably damaging	Het
Fancl	G	T	11: 26,469,677	C305F	probably damaging	Het
Gcnt2	T	C	13: 40,953,579	V308A	probably benign	Het
Gm11733	A	T	11: 117,484,496	I24L	unknown	Het
Gm765	A	T	6: 98,238,276	C129S	probably damaging	Het
Gm973	A	G	1: 59,628,287		probably null	Het
Gm996	T	C	2: 25,579,702	T66A	probably benign	Het
Heatr5b	A	T	17: 78,801,660	F1057I	probably damaging	Het
Ifi213	A	T	1: 173,567,272		probably null	Het
Ighv1-20	A	T	12: 114,723,851	V91E	probably damaging	Het
Inhba	A	G	13: 16,026,786	E311G	probably damaging	Het
Irx3	G	T	8: 91,799,480		probably null	Het
Jag1	C	A	2: 137,084,995	C948F	probably damaging	Het
Kcna2	T	C	3: 107,105,309	I402T	possibly damaging	Het
Kcnh8	A	T	17: 52,977,816	Q938L	possibly damaging	Het
Lrsam1	ACC	AC	2: 32,945,858		probably null	Het
Macf1	T	C	4: 123,450,061	T2123A	probably benign	Het
Mdh1	A	T	11: 21,559,786	N196K	probably benign	Het
Msh6	G	A	17: 87,984,561	R248Q	possibly damaging	Het
Odf2l	G	T	3: 145,146,866	R457L	probably benign	Het
Olfr822	A	T	10: 130,075,029	L206F	probably damaging	Het
Pphln1	T	C	15: 93,488,975	V318A	possibly damaging	Het
Ppp1r12a	C	T	10: 108,240,112	T267I	probably damaging	Het
Pramef20	T	C	4: 144,377,157	D133G	probably benign	Het
Prpf8	A	C	11: 75,503,643	K1801N	possibly damaging	Het
Raf1	A	G	6: 115,626,706		probably null	Het
S1pr3	T	A	13: 51,419,647	V288D	probably damaging	Het
Setd7	G	A	3: 51,521,465	P315S	probably benign	Het
Slx4	C	T	16: 3,991,540	A364T	probably benign	Het
Sp7	G	A	15: 102,359,314	T19I	probably benign	Het
Tlr9	T	A	9: 106,224,313	C268S	probably damaging	Het
Tmem117	T	A	15: 95,094,513	D351E	possibly damaging	Het
Tmem45b	T	A	9: 31,428,044	D211V	possibly damaging	Het
Tns3	A	G	11: 8,451,092	S1069P	probably benign	Het
Tsnax	A	G	8: 125,015,762	I77V	probably benign	Het
Txndc5	G	A	13: 38,513,125	L79F	possibly damaging	Het
Ube2q1	A	G	3: 89,777,241	E14G	probably benign	Het
Vmn2r28	C	T	7: 5,487,944		probably null	Het
Vwde	A	T	6: 13,193,118	D407E	probably benign	Het
Wdr35	T	A	12: 9,016,619	M749K	probably benign	Het
Zfp109	A	T	7: 24,228,621	C462*	probably null	Het

Other mutations in Rasal3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01126:Rasal3	APN	17	32397405	missense	possibly damaging	0.89
IGL02291:Rasal3	APN	17	32393737	unclassified	probably benign
IGL02346:Rasal3	APN	17	32399349	missense	probably damaging	1.00
IGL02422:Rasal3	APN	17	32398973	missense	probably benign	0.11
Beaten	UTSW	17	32391344	missense	probably benign	0.05
bent	UTSW	17	32396781	missense	probably damaging	1.00
bowed	UTSW	17	32396790	missense	probably damaging	1.00
kinked	UTSW	17	32396350	nonsense	probably null
whipped	UTSW	17	32393528	frame shift	probably null
R0057:Rasal3	UTSW	17	32391383	missense	probably benign	0.00
R0133:Rasal3	UTSW	17	32403383	start codon destroyed	probably null	0.89
R0180:Rasal3	UTSW	17	32399405	missense	probably benign
R0403:Rasal3	UTSW	17	32392790	splice site	probably null
R0452:Rasal3	UTSW	17	32395817	splice site	probably benign
R0600:Rasal3	UTSW	17	32393526	missense	probably damaging	0.99
R0760:Rasal3	UTSW	17	32392172	missense	probably benign	0.00
R1438:Rasal3	UTSW	17	32393535	splice site	probably null
R1669:Rasal3	UTSW	17	32403098	missense	possibly damaging	0.81
R1914:Rasal3	UTSW	17	32396350	nonsense	probably null
R1928:Rasal3	UTSW	17	32397353	missense	probably damaging	1.00
R2002:Rasal3	UTSW	17	32393611	missense	probably damaging	1.00
R3053:Rasal3	UTSW	17	32403439	missense	probably benign	0.03
R3770:Rasal3	UTSW	17	32392151	missense	probably damaging	0.99
R3870:Rasal3	UTSW	17	32393548	missense	possibly damaging	0.94
R4491:Rasal3	UTSW	17	32391385	missense	probably damaging	0.99
R4783:Rasal3	UTSW	17	32396781	missense	probably damaging	1.00
R4788:Rasal3	UTSW	17	32399338	missense	probably benign	0.00
R4903:Rasal3	UTSW	17	32397383	missense	probably damaging	1.00
R5185:Rasal3	UTSW	17	32396790	missense	probably damaging	1.00
R5372:Rasal3	UTSW	17	32391344	missense	probably benign	0.05
R5433:Rasal3	UTSW	17	32393601	missense	probably benign	0.00
R5920:Rasal3	UTSW	17	32395169	missense	probably damaging	1.00
R6436:Rasal3	UTSW	17	32397504	missense	probably damaging	1.00
R6837:Rasal3	UTSW	17	32403070	missense	probably benign	0.17
R7047:Rasal3	UTSW	17	32396484	missense	probably damaging	1.00
R7109:Rasal3	UTSW	17	32392709	missense	probably damaging	1.00
R7179:Rasal3	UTSW	17	32392417	missense	probably damaging	0.99
R7571:Rasal3	UTSW	17	32395861	missense	possibly damaging	0.76
R7768:Rasal3	UTSW	17	32396793	missense	probably damaging	0.96
R7874:Rasal3	UTSW	17	32396707	missense	possibly damaging	0.75
R8155:Rasal3	UTSW	17	32397407	missense	possibly damaging	0.93
R8265:Rasal3	UTSW	17	32395820	critical splice donor site	probably null
R8544:Rasal3	UTSW	17	32392119	missense	probably benign
R8677:Rasal3	UTSW	17	32396854	missense	probably benign	0.03
R8695:Rasal3	UTSW	17	32392762	missense	possibly damaging	0.93
R9037:Rasal3	UTSW	17	32395120	missense	probably benign	0.01
R9307:Rasal3	UTSW	17	32393528	frame shift	probably null
R9417:Rasal3	UTSW	17	32396467	missense	probably benign	0.13
R9486:Rasal3	UTSW	17	32398936	missense	probably benign	0.07
R9712:Rasal3	UTSW	17	32396562	missense	probably damaging	0.99
RF004:Rasal3	UTSW	17	32391107	missense	probably damaging	1.00
X0027:Rasal3	UTSW	17	32391219	missense	probably damaging	1.00
X0027:Rasal3	UTSW	17	32392526	missense	probably benign	0.00
X0065:Rasal3	UTSW	17	32403286	missense	probably damaging	1.00
Z1177:Rasal3	UTSW	17	32399310	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- ACTCGGCCAGCTCCTTATAG -3'
(R):5'- TCTTGTATGTAGGACAACGTGG -3'

Sequencing Primer
(F):5'- TCCTTATAGCGCTCCGACGG -3'
(R):5'- CGGCAAGAGATGTGGCTGAC -3'

Posted On

2016-10-06