Incidental Mutation 'R5472:Msh6'
ID433898
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene NamemutS homolog 6
SynonymsGTBP, Gtmbp, Msh6
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5472 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87975050-87990883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87984561 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 248 (R248Q)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005503
AA Change: R248Q

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: R248Q

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Cdk2ap2 C A 19: 4,098,048 T76K probably benign Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 87985479 missense probably benign
IGL01834:Msh6 APN 17 87985712 missense probably damaging 1.00
IGL01904:Msh6 APN 17 87984732 missense probably benign
IGL01957:Msh6 APN 17 87985091 missense possibly damaging 0.73
IGL02117:Msh6 APN 17 87990806 unclassified probably benign
IGL02234:Msh6 APN 17 87986801 missense probably damaging 1.00
IGL02512:Msh6 APN 17 87984732 missense probably benign
IGL02651:Msh6 APN 17 87989515 missense probably damaging 1.00
IGL03381:Msh6 APN 17 87985109 missense probably damaging 1.00
medea UTSW 17 87980223 nonsense probably null
medusa UTSW 17 87988463 unclassified probably benign
PIT4449001:Msh6 UTSW 17 87986188 missense probably damaging 0.96
R0196:Msh6 UTSW 17 87980360 missense possibly damaging 0.95
R0324:Msh6 UTSW 17 87986620 nonsense probably null
R0492:Msh6 UTSW 17 87975251 missense probably benign
R0711:Msh6 UTSW 17 87986684 missense probably damaging 1.00
R1065:Msh6 UTSW 17 87988463 unclassified probably benign
R1454:Msh6 UTSW 17 87984758 missense probably benign 0.00
R1740:Msh6 UTSW 17 87985722 missense possibly damaging 0.72
R1770:Msh6 UTSW 17 87980223 nonsense probably null
R1771:Msh6 UTSW 17 87984522 missense probably benign 0.17
R1919:Msh6 UTSW 17 87985125 missense probably benign 0.01
R1926:Msh6 UTSW 17 87986225 missense probably benign
R2026:Msh6 UTSW 17 87990343 missense probably damaging 1.00
R2095:Msh6 UTSW 17 87988233 missense possibly damaging 0.93
R2097:Msh6 UTSW 17 87985416 missense probably benign 0.00
R2149:Msh6 UTSW 17 87986088 missense probably damaging 1.00
R2156:Msh6 UTSW 17 87986140 nonsense probably null
R2167:Msh6 UTSW 17 87989483 missense probably damaging 1.00
R2382:Msh6 UTSW 17 87984731 missense probably benign
R3005:Msh6 UTSW 17 87988285 missense probably benign 0.34
R3160:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3774:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R3775:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R4350:Msh6 UTSW 17 87984584 missense probably damaging 1.00
R4424:Msh6 UTSW 17 87990789 nonsense probably null
R4499:Msh6 UTSW 17 87980269 missense probably damaging 1.00
R4667:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4668:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4669:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4849:Msh6 UTSW 17 87983519 missense possibly damaging 0.94
R5137:Msh6 UTSW 17 87980288 missense possibly damaging 0.83
R5594:Msh6 UTSW 17 87986069 missense probably benign 0.00
R5607:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5608:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5660:Msh6 UTSW 17 87984719 missense possibly damaging 0.94
R6243:Msh6 UTSW 17 87983571 missense possibly damaging 0.69
R6279:Msh6 UTSW 17 87980249 missense probably damaging 1.00
R6357:Msh6 UTSW 17 87984460 nonsense probably null
R6399:Msh6 UTSW 17 87986891 missense probably damaging 1.00
R6453:Msh6 UTSW 17 87985739 missense probably damaging 1.00
R6646:Msh6 UTSW 17 87986442 missense possibly damaging 0.80
R7404:Msh6 UTSW 17 87975120
R7837:Msh6 UTSW 17 87984666 missense probably damaging 1.00
R8004:Msh6 UTSW 17 87986787 missense probably damaging 1.00
R8296:Msh6 UTSW 17 87986912 missense probably damaging 1.00
R8326:Msh6 UTSW 17 87986912 missense probably damaging 1.00
R8377:Msh6 UTSW 17 87985170 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87986181 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87990614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAACATCTGGGTTCCACAG -3'
(R):5'- GAGCAACCATGGCTCTCTTC -3'

Sequencing Primer
(F):5'- ACATCTGGGTTCCACAGATGTAC -3'
(R):5'- ATGGCTCTCTTCCGCTTTGG -3'
Posted On2016-10-06