Incidental Mutation 'R5472:Cdk2ap2'
ID433899
Institutional Source Beutler Lab
Gene Symbol Cdk2ap2
Ensembl Gene ENSMUSG00000024856
Gene NameCDK2-associated protein 2
Synonyms
MMRRC Submission 043033-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5472 (G1)
Quality Score185
Status Not validated
Chromosome19
Chromosomal Location4097182-4099019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4098048 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 76 (T76K)
Ref Sequence ENSEMBL: ENSMUSP00000134093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025779] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000131265] [ENSMUST00000174149] [ENSMUST00000174514] [ENSMUST00000174799]
Predicted Effect probably benign
Transcript: ENSMUST00000025779
AA Change: T76K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025779
Gene: ENSMUSG00000024856
AA Change: T76K

DomainStartEndE-ValueType
low complexity region 7 44 N/A INTRINSIC
Pfam:CDK2AP 58 126 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049658
SMART Domains Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 2e-145 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100022
SMART Domains Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851

DomainStartEndE-ValueType
Pfam:IP_trans 1 250 1.6e-113 PFAM
low complexity region 284 304 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
low complexity region 342 349 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
low complexity region 557 571 N/A INTRINSIC
low complexity region 578 593 N/A INTRINSIC
DDHD 685 879 5.94e-86 SMART
Blast:DDHD 880 963 2e-42 BLAST
LNS2 1022 1153 1.35e-57 SMART
low complexity region 1184 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131265
SMART Domains Protein: ENSMUSP00000120563
Gene: ENSMUSG00000024851

DomainStartEndE-ValueType
Pfam:IP_trans 1 252 5e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172914
Predicted Effect probably benign
Transcript: ENSMUST00000174149
SMART Domains Protein: ENSMUSP00000134613
Gene: ENSMUSG00000024856

DomainStartEndE-ValueType
low complexity region 7 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174514
AA Change: T76K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134093
Gene: ENSMUSG00000024856
AA Change: T76K

DomainStartEndE-ValueType
Pfam:CDK2AP 30 107 8.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174799
SMART Domains Protein: ENSMUSP00000133593
Gene: ENSMUSG00000024856

DomainStartEndE-ValueType
low complexity region 7 44 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with cyclin-dependent kinase 2 associated protein 1. Pseudogenes associated with this gene are located on chromosomes 7 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,513,429 N506S probably benign Het
BC067074 A G 13: 113,319,169 D583G probably benign Het
Brinp3 A T 1: 146,901,459 H548L possibly damaging Het
Cacna1c A G 6: 118,638,446 V1328A possibly damaging Het
Carmil1 C T 13: 24,155,471 V47I probably damaging Het
Col16a1 T C 4: 130,092,771 probably benign Het
Cxcr4 C A 1: 128,589,625 A100S probably damaging Het
Fancl G T 11: 26,469,677 C305F probably damaging Het
Gcnt2 T C 13: 40,953,579 V308A probably benign Het
Gm11733 A T 11: 117,484,496 I24L unknown Het
Gm765 A T 6: 98,238,276 C129S probably damaging Het
Gm973 A G 1: 59,628,287 probably null Het
Gm996 T C 2: 25,579,702 T66A probably benign Het
Heatr5b A T 17: 78,801,660 F1057I probably damaging Het
Ifi213 A T 1: 173,567,272 probably null Het
Ighv1-20 A T 12: 114,723,851 V91E probably damaging Het
Inhba A G 13: 16,026,786 E311G probably damaging Het
Irx3 G T 8: 91,799,480 probably null Het
Jag1 C A 2: 137,084,995 C948F probably damaging Het
Kcna2 T C 3: 107,105,309 I402T possibly damaging Het
Kcnh8 A T 17: 52,977,816 Q938L possibly damaging Het
Lrsam1 ACC AC 2: 32,945,858 probably null Het
Macf1 T C 4: 123,450,061 T2123A probably benign Het
Mdh1 A T 11: 21,559,786 N196K probably benign Het
Msh6 G A 17: 87,984,561 R248Q possibly damaging Het
Odf2l G T 3: 145,146,866 R457L probably benign Het
Olfr822 A T 10: 130,075,029 L206F probably damaging Het
Pphln1 T C 15: 93,488,975 V318A possibly damaging Het
Ppp1r12a C T 10: 108,240,112 T267I probably damaging Het
Pramef20 T C 4: 144,377,157 D133G probably benign Het
Prpf8 A C 11: 75,503,643 K1801N possibly damaging Het
Raf1 A G 6: 115,626,706 probably null Het
Rasal3 C A 17: 32,396,669 L374F probably damaging Het
S1pr3 T A 13: 51,419,647 V288D probably damaging Het
Setd7 G A 3: 51,521,465 P315S probably benign Het
Slx4 C T 16: 3,991,540 A364T probably benign Het
Sp7 G A 15: 102,359,314 T19I probably benign Het
Tlr9 T A 9: 106,224,313 C268S probably damaging Het
Tmem117 T A 15: 95,094,513 D351E possibly damaging Het
Tmem45b T A 9: 31,428,044 D211V possibly damaging Het
Tns3 A G 11: 8,451,092 S1069P probably benign Het
Tsnax A G 8: 125,015,762 I77V probably benign Het
Txndc5 G A 13: 38,513,125 L79F possibly damaging Het
Ube2q1 A G 3: 89,777,241 E14G probably benign Het
Vmn2r28 C T 7: 5,487,944 probably null Het
Vwde A T 6: 13,193,118 D407E probably benign Het
Wdr35 T A 12: 9,016,619 M749K probably benign Het
Zfp109 A T 7: 24,228,621 C462* probably null Het
Other mutations in Cdk2ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4402001:Cdk2ap2 UTSW 19 4098557 missense probably damaging 0.98
R2001:Cdk2ap2 UTSW 19 4097903 missense possibly damaging 0.88
R2002:Cdk2ap2 UTSW 19 4097903 missense possibly damaging 0.88
R4569:Cdk2ap2 UTSW 19 4097879 missense possibly damaging 0.85
R4942:Cdk2ap2 UTSW 19 4097508 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGACCGCTGTTTAACGACTTTG -3'
(R):5'- GTTCTGTTCCAATCGAGGCTG -3'

Sequencing Primer
(F):5'- AACGACTTTGGTCCGCC -3'
(R):5'- CAATCGAGGCTGGCCCAAATG -3'
Posted On2016-10-06