Incidental Mutation 'R0481:Cdk13'
ID43390
Institutional Source Beutler Lab
Gene Symbol Cdk13
Ensembl Gene ENSMUSG00000041297
Gene Namecyclin-dependent kinase 13
Synonyms2310015O17Rik, Cdc2l5
MMRRC Submission 038681-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0481 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location17710315-17805097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17719494 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1123 (A1123S)
Ref Sequence ENSEMBL: ENSMUSP00000152820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042365] [ENSMUST00000222800] [ENSMUST00000223490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042365
AA Change: A1183S

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036013
Gene: ENSMUSG00000041297
AA Change: A1183S

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 32 86 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 130 139 N/A INTRINSIC
low complexity region 160 187 N/A INTRINSIC
low complexity region 189 225 N/A INTRINSIC
low complexity region 238 272 N/A INTRINSIC
low complexity region 337 377 N/A INTRINSIC
low complexity region 384 402 N/A INTRINSIC
low complexity region 405 442 N/A INTRINSIC
low complexity region 450 490 N/A INTRINSIC
internal_repeat_1 553 599 6.15e-5 PROSPERO
low complexity region 607 617 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 645 661 N/A INTRINSIC
S_TKc 705 998 7.25e-94 SMART
low complexity region 1173 1184 N/A INTRINSIC
internal_repeat_1 1190 1236 6.15e-5 PROSPERO
low complexity region 1248 1273 N/A INTRINSIC
low complexity region 1299 1311 N/A INTRINSIC
low complexity region 1355 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222359
Predicted Effect possibly damaging
Transcript: ENSMUST00000222800
AA Change: A509S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000223490
AA Change: A1123S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 95% (89/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the cyclin-dependent serine/threonine protein kinase family. Members of this family are well known for their essential roles as master switches in cell cycle control. The exact function of this protein has not yet been determined, but it may play a role in mRNA processing and may be involved in regulation of hematopoiesis. Alternatively spliced transcript variants have been described.[provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932429P05Rik T C X: 89,752,693 S44P probably damaging Het
9530053A07Rik A T 7: 28,153,749 D1487V probably damaging Het
Abcg4 T A 9: 44,279,369 N39Y probably benign Het
Adamts10 C T 17: 33,549,373 Q840* probably null Het
Aff2 C T X: 69,834,642 T678I probably damaging Het
Ahctf1 A G 1: 179,760,271 V1418A probably benign Het
Ankrd11 G A 8: 122,900,036 R136C probably damaging Het
Arf5 A G 6: 28,426,076 Y154C probably damaging Het
AW551984 A G 9: 39,600,616 V33A probably null Het
B4galt5 A G 2: 167,309,234 L118P probably damaging Het
Bcl9l A G 9: 44,506,682 I606V probably benign Het
Bdp1 A G 13: 100,041,454 I1969T probably benign Het
Bicd1 A T 6: 149,511,891 D260V possibly damaging Het
Cap1 A T 4: 122,863,075 H272Q possibly damaging Het
Ccnk A G 12: 108,199,309 probably benign Het
Cd209f A T 8: 4,105,558 probably null Het
Cdx1 C T 18: 61,020,492 R158H probably damaging Het
Chd8 A G 14: 52,237,206 S123P probably benign Het
Cwc22 G A 2: 77,908,111 A497V probably damaging Het
Cwh43 T C 5: 73,418,027 S296P probably damaging Het
Dhx38 A T 8: 109,556,216 probably benign Het
Dnah5 T A 15: 28,383,599 M2989K probably benign Het
Dpy19l4 A C 4: 11,272,993 probably benign Het
F11r A T 1: 171,461,279 H155L probably benign Het
Fitm2 A G 2: 163,469,714 V193A probably benign Het
Foxk1 T A 5: 142,448,823 S281T probably benign Het
Furin A G 7: 80,393,549 C305R probably damaging Het
Fut8 T A 12: 77,448,560 V308D probably damaging Het
Gjb3 T A 4: 127,326,332 I136F probably benign Het
Glmn A T 5: 107,560,934 S385T probably benign Het
Glp1r T A 17: 30,931,217 M371K probably benign Het
Gm906 T A 13: 50,246,964 Q442L probably benign Het
Gpr179 T C 11: 97,349,718 H293R probably damaging Het
H2-M11 A T 17: 36,548,954 R280* probably null Het
Hadhb T A 5: 30,168,545 H78Q probably damaging Het
Hectd4 A G 5: 121,295,506 probably benign Het
Hexa A G 9: 59,555,410 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Hyal6 G A 6: 24,743,418 C371Y probably damaging Het
Il1rap T C 16: 26,692,835 Y210H probably damaging Het
Ino80 A T 2: 119,431,016 H722Q probably damaging Het
Kcnt1 A G 2: 25,892,496 N200S probably damaging Het
Kif27 T A 13: 58,311,264 probably benign Het
Lyst T C 13: 13,677,952 V2179A probably benign Het
Macf1 C A 4: 123,484,022 probably null Het
Mamdc4 A G 2: 25,571,216 M1T probably null Het
Mansc4 A G 6: 147,075,227 I297T possibly damaging Het
Mdn1 G A 4: 32,767,182 probably benign Het
Mib2 A G 4: 155,656,062 probably benign Het
Mon2 A G 10: 123,013,396 V1333A possibly damaging Het
Ndst2 T C 14: 20,724,468 D840G possibly damaging Het
Nell2 A T 15: 95,432,682 probably null Het
Olfr1189 A T 2: 88,592,655 I284F probably damaging Het
Olfr1301 T A 2: 111,754,585 M112K probably damaging Het
Olfr998 C A 2: 85,591,104 A188E possibly damaging Het
Pde5a C T 3: 122,818,077 probably benign Het
Phip A G 9: 82,876,716 probably benign Het
Polr2b A G 5: 77,332,082 I561V possibly damaging Het
Prkg2 A T 5: 98,994,655 probably null Het
Prl8a6 T C 13: 27,433,101 D201G probably benign Het
Ptk6 G A 2: 181,202,527 probably benign Het
Ptprn2 T C 12: 117,211,846 probably benign Het
Rdh1 G T 10: 127,763,124 R158L probably damaging Het
Rhbdl3 T C 11: 80,323,349 probably benign Het
Rims4 A T 2: 163,864,120 V198E probably damaging Het
Ripk1 T C 13: 34,009,750 S32P probably damaging Het
Rnf13 T A 3: 57,779,451 N88K probably damaging Het
Rnf13 C A 3: 57,807,053 L178I probably damaging Het
Slc17a5 G T 9: 78,538,302 probably null Het
Sorcs1 A G 19: 50,636,453 probably benign Het
Srpk1 G A 17: 28,590,244 probably benign Het
Stk10 A G 11: 32,614,708 K840E probably damaging Het
Suco A G 1: 161,862,313 probably benign Het
T2 G A 17: 8,417,175 probably null Het
Tbc1d5 A G 17: 50,919,051 S255P probably damaging Het
Tenm1 T C X: 42,536,181 Y2254C probably damaging Het
Tex9 T A 9: 72,478,396 K11* probably null Het
Tlr4 A G 4: 66,827,916 I29V probably benign Het
Tmem255a A T X: 38,199,646 V278D probably damaging Het
Trpc3 T C 3: 36,624,417 I840V probably benign Het
Trpm3 G A 19: 22,901,071 R622Q possibly damaging Het
Vmn1r214 T A 13: 23,035,294 Y319* probably null Het
Vmn1r53 A T 6: 90,223,718 V208E probably damaging Het
Vmn2r89 T C 14: 51,456,120 F309S probably damaging Het
Xirp2 T A 2: 67,509,909 F831L possibly damaging Het
Yes1 G T 5: 32,640,405 E23* probably null Het
Zfp292 A T 4: 34,810,059 M995K probably benign Het
Other mutations in Cdk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Cdk13 APN 13 17721098 missense possibly damaging 0.88
IGL00800:Cdk13 APN 13 17728142 missense probably damaging 1.00
IGL02186:Cdk13 APN 13 17772527 missense probably benign 0.02
IGL02447:Cdk13 APN 13 17772416 missense probably benign 0.10
IGL02494:Cdk13 APN 13 17739125 nonsense probably null
IGL02542:Cdk13 APN 13 17728178 missense probably damaging 0.99
IGL02602:Cdk13 APN 13 17727160 missense probably damaging 0.99
Vortex UTSW 13 17739154 missense probably damaging 1.00
Whirlpool UTSW 13 17772403 missense possibly damaging 0.92
R0115:Cdk13 UTSW 13 17719494 missense probably damaging 0.99
R0421:Cdk13 UTSW 13 17763170 missense probably damaging 0.99
R0681:Cdk13 UTSW 13 17721297 splice site probably benign
R1432:Cdk13 UTSW 13 17718416 missense probably damaging 1.00
R2013:Cdk13 UTSW 13 17739163 nonsense probably null
R2221:Cdk13 UTSW 13 17719535 missense probably damaging 0.99
R2332:Cdk13 UTSW 13 17718695 missense probably damaging 1.00
R2389:Cdk13 UTSW 13 17751776 missense probably damaging 1.00
R4546:Cdk13 UTSW 13 17766574 missense probably damaging 0.98
R4753:Cdk13 UTSW 13 17763248 missense probably damaging 1.00
R4855:Cdk13 UTSW 13 17721283 missense probably damaging 1.00
R4856:Cdk13 UTSW 13 17719734 missense probably benign
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4861:Cdk13 UTSW 13 17766586 missense probably damaging 1.00
R4886:Cdk13 UTSW 13 17719734 missense probably benign
R4909:Cdk13 UTSW 13 17772403 missense possibly damaging 0.92
R5152:Cdk13 UTSW 13 17718525 missense probably benign 0.13
R5308:Cdk13 UTSW 13 17772313 missense probably damaging 0.98
R5350:Cdk13 UTSW 13 17803930 unclassified probably benign
R5412:Cdk13 UTSW 13 17766530 missense probably damaging 1.00
R5493:Cdk13 UTSW 13 17803562 unclassified probably benign
R5719:Cdk13 UTSW 13 17719655 missense probably damaging 0.98
R6052:Cdk13 UTSW 13 17721215 missense probably damaging 1.00
R6349:Cdk13 UTSW 13 17751719 missense probably damaging 1.00
R6415:Cdk13 UTSW 13 17739154 missense probably damaging 1.00
R7665:Cdk13 UTSW 13 17772553 missense possibly damaging 0.78
R7666:Cdk13 UTSW 13 17772576 start gained probably benign
R7764:Cdk13 UTSW 13 17721305 splice site probably null
RF009:Cdk13 UTSW 13 17803744 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCACACAGTCGTACTGAATGCTTG -3'
(R):5'- CAGCCGTTAAACCACAGTGAATTGG -3'

Sequencing Primer
(F):5'- CTTCTCACAAGGGACCTGAGAATG -3'
(R):5'- CCACAGTGAATTGGCAATTCTTC -3'
Posted On2013-05-23