Mutagenetix > Incidental Mutation

Incidental Mutation 'R5473:Col24a1'

433916

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

043034-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5473 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 145537261 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1519 (M1519L)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: M1519L

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: M1519L

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127379

Meta Mutation Damage Score

0.1300

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.2%
20x: 90.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	T	C	7: 119,712,950	Y549H	probably damaging	Het
Adamtsl4	G	T	3: 95,679,993	Q758K	probably damaging	Het
Anapc1	G	T	2: 128,607,195		probably benign	Het
Ankrd26	A	T	6: 118,515,836	C1316S	probably benign	Het
Birc5	T	C	11: 117,852,707	V89A	possibly damaging	Het
Camk2d	G	T	3: 126,597,399		probably benign	Het
Ccdc47	A	T	11: 106,205,029	S280R	probably damaging	Het
Cntnap5a	T	A	1: 116,089,256	F193Y	probably benign	Het
Cntrob	G	T	11: 69,322,753	D70E	possibly damaging	Het
Col2a1	G	T	15: 97,987,489	A491D	unknown	Het
Crat	A	G	2: 30,407,714	L266P	probably damaging	Het
Dlgap1	A	T	17: 70,517,030		probably benign	Het
Eya4	T	A	10: 23,163,453	H104L	probably benign	Het
Fam83b	T	C	9: 76,491,500	K774E	probably damaging	Het
Fgd6	T	C	10: 94,044,676	I464T	probably benign	Het
Gorasp2	A	C	2: 70,678,606	M123L	probably damaging	Het
H2-M10.3	A	T	17: 36,367,369	V188E	probably damaging	Het
Hnrnpk	A	T	13: 58,394,099	W333R	probably damaging	Het
Hrh4	T	C	18: 13,021,928	Y175H	probably benign	Het
Igf2r	G	T	17: 12,695,314	T1756K	probably benign	Het
Kcnq5	A	G	1: 21,457,402		probably null	Het
Kiz	G	T	2: 146,969,995	E675*	probably null	Het
Mcm3ap	T	G	10: 76,502,759	L1407R	probably damaging	Het
Mdc1	A	G	17: 35,848,060	D444G	probably benign	Het
Myl3	C	A	9: 110,767,958	H129N	probably damaging	Het
Neo1	T	C	9: 58,880,843	N1309S	possibly damaging	Het
Nrxn1	A	T	17: 90,590,092	Y269N	probably damaging	Het
Nsd1	A	G	13: 55,247,772	N1165S	probably damaging	Het
Nuf2	T	C	1: 169,507,287	D302G	probably benign	Het
Olfr1166	A	T	2: 88,124,637	M116K	possibly damaging	Het
Olfr125	T	C	17: 37,835,739	F247L	probably benign	Het
Olfr218	G	C	1: 173,204,165	G270R	probably benign	Het
Olfr908	A	G	9: 38,516,212	Y60C	probably damaging	Het
Oxsm	A	T	14: 16,242,045	S241R	probably damaging	Het
Pde1a	G	T	2: 79,906,028	S87R	probably damaging	Het
Plagl2	A	T	2: 153,232,194	C262*	probably null	Het
Plcg2	A	G	8: 117,634,401	K1233R	probably benign	Het
Pon3	A	T	6: 5,256,177	I17K	possibly damaging	Het
Ppfia1	A	T	7: 144,491,492	M951K	probably benign	Het
Pramef8	A	G	4: 143,419,304	R448G	probably damaging	Het
Prpf31	A	G	7: 3,639,825	K438E	probably benign	Het
Pum3	C	A	19: 27,418,848	V328F	probably damaging	Het
Ralgapa1	T	C	12: 55,676,710	E1677G	probably benign	Het
Rpf2	A	G	10: 40,227,631	V96A	possibly damaging	Het
Rsrc2	C	T	5: 123,731,087	A98T	probably damaging	Het
Saraf	G	A	8: 34,161,258	R86Q	probably damaging	Het
Scara5	T	A	14: 65,740,339	D349E	possibly damaging	Het
Slc30a1	T	C	1: 191,909,622	V460A	possibly damaging	Het
Tdrd7	G	T	4: 46,020,877	V768L	possibly damaging	Het
Tshz2	T	C	2: 169,883,798	S105P	probably benign	Het
Ufsp2	A	G	8: 45,992,221	I362M	probably damaging	Het
Ugt1a7c	T	A	1: 88,095,437	I106K	probably benign	Het
Wdr92	T	C	11: 17,224,591	V153A	probably damaging	Het
Zdhhc5	A	G	2: 84,690,466	Y456H	probably damaging	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGTTTCGCATCAAGGCTCC -3'
(R):5'- GAACACCCCGTGTATGTATTTCGG -3'

Sequencing Primer
(F):5'- CCAGAACAAAATGAACAGAGGTTGTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2016-10-06