Mutagenetix > Incidental Mutations

Incidental Mutation 'R5473:Fgd6'

433938

Institutional Source

Beutler Lab

Gene Symbol

Fgd6

Ensembl Gene

ENSMUSG00000020021

Gene Name

FYVE, RhoGEF and PH domain containing 6

Synonyms

Etohd4, ZFYVE24

MMRRC Submission

043034-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.450) question?

Stock #

R5473 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94036001-94145339 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94044676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 464 (I464T)

Ref Sequence

ENSEMBL: ENSMUSP00000020208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020208]

AlphaFold

Q69ZL1

PDB Structure

Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000020208
AA Change: I464T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: I464T

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	24	34	N/A	INTRINSIC
low complexity region	45	60	N/A	INTRINSIC
low complexity region	75	88	N/A	INTRINSIC
low complexity region	150	161	N/A	INTRINSIC
low complexity region	403	418	N/A	INTRINSIC
low complexity region	803	821	N/A	INTRINSIC
RhoGEF	845	1029	3.09e-46	SMART
PH	1060	1155	6.25e-15	SMART
FYVE	1183	1251	6.93e-28	SMART
low complexity region	1268	1282	N/A	INTRINSIC
PH	1303	1398	1.54e-5	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.2%
20x: 90.6%

Validation Efficiency

100% (66/66)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	T	C	7: 119,712,950	Y549H	probably damaging	Het
Adamtsl4	G	T	3: 95,679,993	Q758K	probably damaging	Het
Anapc1	G	T	2: 128,607,195		probably benign	Het
Ankrd26	A	T	6: 118,515,836	C1316S	probably benign	Het
Birc5	T	C	11: 117,852,707	V89A	possibly damaging	Het
Camk2d	G	T	3: 126,597,399		probably benign	Het
Ccdc47	A	T	11: 106,205,029	S280R	probably damaging	Het
Cntnap5a	T	A	1: 116,089,256	F193Y	probably benign	Het
Cntrob	G	T	11: 69,322,753	D70E	possibly damaging	Het
Col24a1	A	C	3: 145,537,261	M1519L	probably benign	Het
Col2a1	G	T	15: 97,987,489	A491D	unknown	Het
Crat	A	G	2: 30,407,714	L266P	probably damaging	Het
Dlgap1	A	T	17: 70,517,030		probably benign	Het
Eya4	T	A	10: 23,163,453	H104L	probably benign	Het
Fam83b	T	C	9: 76,491,500	K774E	probably damaging	Het
Gorasp2	A	C	2: 70,678,606	M123L	probably damaging	Het
H2-M10.3	A	T	17: 36,367,369	V188E	probably damaging	Het
Hnrnpk	A	T	13: 58,394,099	W333R	probably damaging	Het
Hrh4	T	C	18: 13,021,928	Y175H	probably benign	Het
Igf2r	G	T	17: 12,695,314	T1756K	probably benign	Het
Kcnq5	A	G	1: 21,457,402		probably null	Het
Kiz	G	T	2: 146,969,995	E675*	probably null	Het
Mcm3ap	T	G	10: 76,502,759	L1407R	probably damaging	Het
Mdc1	A	G	17: 35,848,060	D444G	probably benign	Het
Myl3	C	A	9: 110,767,958	H129N	probably damaging	Het
Neo1	T	C	9: 58,880,843	N1309S	possibly damaging	Het
Nrxn1	A	T	17: 90,590,092	Y269N	probably damaging	Het
Nsd1	A	G	13: 55,247,772	N1165S	probably damaging	Het
Nuf2	T	C	1: 169,507,287	D302G	probably benign	Het
Olfr1166	A	T	2: 88,124,637	M116K	possibly damaging	Het
Olfr125	T	C	17: 37,835,739	F247L	probably benign	Het
Olfr218	G	C	1: 173,204,165	G270R	probably benign	Het
Olfr908	A	G	9: 38,516,212	Y60C	probably damaging	Het
Oxsm	A	T	14: 16,242,045	S241R	probably damaging	Het
Pde1a	G	T	2: 79,906,028	S87R	probably damaging	Het
Plagl2	A	T	2: 153,232,194	C262*	probably null	Het
Plcg2	A	G	8: 117,634,401	K1233R	probably benign	Het
Pon3	A	T	6: 5,256,177	I17K	possibly damaging	Het
Ppfia1	A	T	7: 144,491,492	M951K	probably benign	Het
Pramef8	A	G	4: 143,419,304	R448G	probably damaging	Het
Prpf31	A	G	7: 3,639,825	K438E	probably benign	Het
Pum3	C	A	19: 27,418,848	V328F	probably damaging	Het
Ralgapa1	T	C	12: 55,676,710	E1677G	probably benign	Het
Rpf2	A	G	10: 40,227,631	V96A	possibly damaging	Het
Rsrc2	C	T	5: 123,731,087	A98T	probably damaging	Het
Saraf	G	A	8: 34,161,258	R86Q	probably damaging	Het
Scara5	T	A	14: 65,740,339	D349E	possibly damaging	Het
Slc30a1	T	C	1: 191,909,622	V460A	possibly damaging	Het
Tdrd7	G	T	4: 46,020,877	V768L	possibly damaging	Het
Tshz2	T	C	2: 169,883,798	S105P	probably benign	Het
Ufsp2	A	G	8: 45,992,221	I362M	probably damaging	Het
Ugt1a7c	T	A	1: 88,095,437	I106K	probably benign	Het
Wdr92	T	C	11: 17,224,591	V153A	probably damaging	Het
Zdhhc5	A	G	2: 84,690,466	Y456H	probably damaging	Het

Other mutations in Fgd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Fgd6	APN	10	94043634	missense	probably benign	0.01
IGL00975:Fgd6	APN	10	94134076	missense	probably damaging	0.98
IGL01366:Fgd6	APN	10	94043476	missense	possibly damaging	0.71
IGL01940:Fgd6	APN	10	94089650	splice site	probably null
IGL01958:Fgd6	APN	10	94138308	missense	probably benign	0.25
IGL01988:Fgd6	APN	10	94074335	splice site	probably benign
IGL02019:Fgd6	APN	10	94133354	missense	probably damaging	1.00
IGL02074:Fgd6	APN	10	94127435	missense	probably damaging	1.00
IGL02227:Fgd6	APN	10	94134084	missense	probably damaging	1.00
IGL02262:Fgd6	APN	10	94125628	missense	probably damaging	0.98
IGL02353:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02360:Fgd6	APN	10	94138396	missense	possibly damaging	0.82
IGL02425:Fgd6	APN	10	94074202	missense	probably benign	0.00
IGL02526:Fgd6	APN	10	94100511	missense	probably benign	0.21
IGL02607:Fgd6	APN	10	94044448	missense	possibly damaging	0.94
IGL02741:Fgd6	APN	10	94123290	missense	possibly damaging	0.65
IGL02870:Fgd6	APN	10	94045164	missense	probably damaging	1.00
IGL02884:Fgd6	APN	10	94045639	splice site	probably benign
IGL02995:Fgd6	APN	10	94045480	nonsense	probably null
IGL03189:Fgd6	APN	10	94044456	missense	probably benign	0.26
IGL03258:Fgd6	APN	10	94133353	missense	probably benign	0.44
IGL03396:Fgd6	APN	10	94044456	missense	probably benign	0.26
FR4449:Fgd6	UTSW	10	94044320	small deletion	probably benign
R0257:Fgd6	UTSW	10	94043915	missense	probably benign	0.11
R0926:Fgd6	UTSW	10	94135047	missense	probably benign	0.40
R1325:Fgd6	UTSW	10	94127427	missense	probably damaging	1.00
R1422:Fgd6	UTSW	10	94045372	missense	probably damaging	1.00
R1491:Fgd6	UTSW	10	94044832	missense	probably benign	0.06
R1593:Fgd6	UTSW	10	94045032	missense	probably damaging	1.00
R1624:Fgd6	UTSW	10	94137436	missense	probably benign	0.19
R1929:Fgd6	UTSW	10	94045006	missense	probably benign	0.01
R2064:Fgd6	UTSW	10	94045041	missense	probably damaging	0.98
R2965:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R2966:Fgd6	UTSW	10	94044194	missense	probably benign	0.03
R3889:Fgd6	UTSW	10	94089637	missense	probably damaging	1.00
R4094:Fgd6	UTSW	10	94043434	missense	probably damaging	1.00
R4605:Fgd6	UTSW	10	94044355	missense	probably benign	0.12
R4883:Fgd6	UTSW	10	94139853	missense	probably benign	0.00
R5217:Fgd6	UTSW	10	94134077	missense	possibly damaging	0.90
R5606:Fgd6	UTSW	10	94138328	nonsense	probably null
R5644:Fgd6	UTSW	10	94134050	missense	possibly damaging	0.80
R6051:Fgd6	UTSW	10	94137565	critical splice donor site	probably null
R6258:Fgd6	UTSW	10	94044299	missense	probably benign	0.00
R6735:Fgd6	UTSW	10	94074320	missense	possibly damaging	0.94
R7181:Fgd6	UTSW	10	94043511	missense	probably benign	0.02
R7210:Fgd6	UTSW	10	94134092	missense	probably damaging	0.98
R7296:Fgd6	UTSW	10	94044047	nonsense	probably null
R7296:Fgd6	UTSW	10	94139881	missense	probably benign	0.02
R7697:Fgd6	UTSW	10	94045444	missense	probably damaging	0.99
R7747:Fgd6	UTSW	10	94044916	missense	probably damaging	1.00
R7861:Fgd6	UTSW	10	94103331	missense	probably benign	0.15
R7940:Fgd6	UTSW	10	94120482	missense	probably benign	0.02
R8022:Fgd6	UTSW	10	94044344	missense	possibly damaging	0.54
R8138:Fgd6	UTSW	10	94134143	missense	probably null	0.45
R8171:Fgd6	UTSW	10	94074332	critical splice donor site	probably null
R8189:Fgd6	UTSW	10	94074215	missense	probably benign	0.00
R8213:Fgd6	UTSW	10	94044052	missense	probably benign	0.37
R8960:Fgd6	UTSW	10	94045006	missense	probably benign	0.06
R8981:Fgd6	UTSW	10	94045054	missense	possibly damaging	0.80
R8989:Fgd6	UTSW	10	94123563	missense	probably damaging	0.97
RF031:Fgd6	UTSW	10	94044325	frame shift	probably null
RF040:Fgd6	UTSW	10	94044325	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCAAACGCCTTCTTTAGATACAG -3'
(R):5'- TCAAAGGGTGATGCTGACGC -3'

Sequencing Primer
(F):5'- GATTCTAGTTTGACTTCTGACAGCAG -3'
(R):5'- CTGACGCGCCATGGTTTG -3'

Posted On

2016-10-06