Incidental Mutation 'R5474:Gtdc1'
ID433961
Institutional Source Beutler Lab
Gene Symbol Gtdc1
Ensembl Gene ENSMUSG00000036890
Gene Nameglycosyltransferase-like domain containing 1
Synonyms
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location44564412-44927657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44756367 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 83 (L83Q)
Ref Sequence ENSEMBL: ENSMUSP00000120593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049051] [ENSMUST00000112810] [ENSMUST00000130991] [ENSMUST00000146694] [ENSMUST00000148279] [ENSMUST00000154744]
Predicted Effect probably damaging
Transcript: ENSMUST00000049051
AA Change: L24Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038119
Gene: ENSMUSG00000036890
AA Change: L24Q

DomainStartEndE-ValueType
Pfam:DUF3524 1 108 1.4e-44 PFAM
Pfam:Glycos_transf_1 208 360 4.9e-13 PFAM
Pfam:Glyco_trans_1_4 210 348 2.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112810
AA Change: L83Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108429
Gene: ENSMUSG00000036890
AA Change: L83Q

DomainStartEndE-ValueType
Pfam:DUF3524 2 167 1.3e-74 PFAM
Pfam:Glycos_transf_1 266 444 1.3e-10 PFAM
Pfam:Glyco_trans_1_4 269 407 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129240
Predicted Effect probably benign
Transcript: ENSMUST00000130991
SMART Domains Protein: ENSMUSP00000116839
Gene: ENSMUSG00000036890

DomainStartEndE-ValueType
Pfam:DUF3524 1 87 1.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146694
AA Change: L83Q

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119639
Gene: ENSMUSG00000036890
AA Change: L83Q

DomainStartEndE-ValueType
Pfam:DUF3524 1 116 1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148279
AA Change: L83Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120593
Gene: ENSMUSG00000036890
AA Change: L83Q

DomainStartEndE-ValueType
Pfam:DUF3524 1 167 8.7e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148786
Predicted Effect probably damaging
Transcript: ENSMUST00000154744
AA Change: L83Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119239
Gene: ENSMUSG00000036890
AA Change: L83Q

DomainStartEndE-ValueType
Pfam:DUF3524 1 115 2.3e-44 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Gtdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Gtdc1 APN 2 44591879 critical splice donor site probably null
IGL02133:Gtdc1 APN 2 44575443 missense probably damaging 1.00
IGL02465:Gtdc1 APN 2 44570423 missense probably damaging 1.00
IGL02488:Gtdc1 APN 2 44825439 missense probably benign 0.38
IGL02835:Gtdc1 UTSW 2 44756312 nonsense probably null
K3955:Gtdc1 UTSW 2 44752221 critical splice acceptor site probably null
R0121:Gtdc1 UTSW 2 44565538 splice site probably benign
R0270:Gtdc1 UTSW 2 44752174 missense possibly damaging 0.94
R0490:Gtdc1 UTSW 2 44635040 missense probably benign 0.03
R1506:Gtdc1 UTSW 2 44575494 missense possibly damaging 0.65
R1889:Gtdc1 UTSW 2 44591914 missense probably damaging 1.00
R1944:Gtdc1 UTSW 2 44752186 missense possibly damaging 0.95
R3724:Gtdc1 UTSW 2 44756307 missense probably damaging 0.96
R4134:Gtdc1 UTSW 2 44825418 missense probably damaging 1.00
R4416:Gtdc1 UTSW 2 44575590 splice site probably null
R4666:Gtdc1 UTSW 2 44591925 missense probably benign 0.05
R4732:Gtdc1 UTSW 2 44789055 intron probably benign
R4947:Gtdc1 UTSW 2 44591956 missense probably null 0.01
R5911:Gtdc1 UTSW 2 44752064 missense probably benign 0.41
R6370:Gtdc1 UTSW 2 44756322 missense probably damaging 0.99
R6809:Gtdc1 UTSW 2 44575551 nonsense probably null
R6809:Gtdc1 UTSW 2 44825384 missense probably damaging 1.00
R7270:Gtdc1 UTSW 2 44635310 missense probably benign 0.01
R7581:Gtdc1 UTSW 2 44790005 splice site probably null
R8547:Gtdc1 UTSW 2 44788981 intron probably benign
X0063:Gtdc1 UTSW 2 44570447 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCCTGTGTATATGCACC -3'
(R):5'- ACTGTGTGAGACTGCTTCTGC -3'

Sequencing Primer
(F):5'- CCCACCCCGAAAAATCTGTGTTG -3'
(R):5'- TGCTTCTGCATGGTACTATATAGC -3'
Posted On2016-10-06