Incidental Mutation 'R5474:Olfr1136'
ID433962
Institutional Source Beutler Lab
Gene Symbol Olfr1136
Ensembl Gene ENSMUSG00000075151
Gene Nameolfactory receptor 1136
SynonymsMOR177-3, GA_x6K02T2Q125-49193051-49192119
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87692881-87693947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87693057 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 275 (S275F)
Ref Sequence ENSEMBL: ENSMUSP00000076681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077471] [ENSMUST00000099852]
Predicted Effect probably damaging
Transcript: ENSMUST00000077471
AA Change: S275F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076681
Gene: ENSMUSG00000075151
AA Change: S275F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 6e-48 PFAM
Pfam:7tm_1 40 289 2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099852
AA Change: S275F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097438
Gene: ENSMUSG00000068815
AA Change: S275F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2e-41 PFAM
Pfam:7tm_1 41 290 4.3e-14 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Olfr1136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01809:Olfr1136 APN 2 87693745 missense possibly damaging 0.73
IGL02190:Olfr1136 APN 2 87693063 missense probably benign 0.21
IGL02902:Olfr1136 APN 2 87693000 missense probably damaging 1.00
PIT4508001:Olfr1136 UTSW 2 87693715 missense probably damaging 1.00
R0153:Olfr1136 UTSW 2 87693604 missense probably benign 0.05
R0665:Olfr1136 UTSW 2 87693808 missense probably benign 0.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1462:Olfr1136 UTSW 2 87693376 missense probably damaging 1.00
R1518:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R1812:Olfr1136 UTSW 2 87693103 missense probably benign 0.01
R1993:Olfr1136 UTSW 2 87693433 missense probably benign 0.07
R2098:Olfr1136 UTSW 2 87693729 missense probably benign 0.25
R3106:Olfr1136 UTSW 2 87693505 missense probably damaging 0.98
R4622:Olfr1136 UTSW 2 87693643 nonsense probably null
R4694:Olfr1136 UTSW 2 87693760 missense probably benign 0.03
R5079:Olfr1136 UTSW 2 87693208 missense probably damaging 0.99
R6432:Olfr1136 UTSW 2 87693528 missense probably damaging 1.00
R6667:Olfr1136 UTSW 2 87693570 missense probably benign 0.00
R7519:Olfr1136 UTSW 2 87693409 missense probably benign 0.01
R7652:Olfr1136 UTSW 2 87693360 missense probably damaging 1.00
R7657:Olfr1136 UTSW 2 87692992 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATGATATTGACTCATGGGAATGCTG -3'
(R):5'- TGGTTTCATTGAACTAAGCACC -3'

Sequencing Primer
(F):5'- TTGACTCATGGGAATGCTGGAATAC -3'
(R):5'- AAGCACCATCTCAGGAGTTCTTG -3'
Posted On2016-10-06