Incidental Mutation 'R5474:Kcnc4'
ID433963
Institutional Source Beutler Lab
Gene Symbol Kcnc4
Ensembl Gene ENSMUSG00000027895
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 4
SynonymsKcr2-4, Kv3.4
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107438303-107459552 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107447891 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 414 (S414T)
Ref Sequence ENSEMBL: ENSMUSP00000009617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009617
AA Change: S414T

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000009617
Gene: ENSMUSG00000027895
AA Change: S414T

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 29 3e-23 PFAM
BTB 36 155 4.66e-16 SMART
low complexity region 168 185 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
Pfam:Ion_trans 229 487 2.6e-46 PFAM
Pfam:Ion_trans_2 386 480 3e-12 PFAM
low complexity region 489 505 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Kcnc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnc4 APN 3 107447873 missense probably benign 0.01
IGL00899:Kcnc4 APN 3 107458463 missense possibly damaging 0.94
IGL01755:Kcnc4 APN 3 107448175 missense probably damaging 1.00
IGL01895:Kcnc4 APN 3 107448218 missense probably benign 0.01
IGL02741:Kcnc4 APN 3 107447978 missense probably damaging 0.98
IGL03393:Kcnc4 APN 3 107447927 missense possibly damaging 0.75
PIT4151001:Kcnc4 UTSW 3 107458703 missense probably damaging 1.00
PIT4378001:Kcnc4 UTSW 3 107447563 missense probably benign
R0158:Kcnc4 UTSW 3 107458604 missense probably benign 0.21
R0415:Kcnc4 UTSW 3 107445433 missense probably damaging 1.00
R0704:Kcnc4 UTSW 3 107447963 missense possibly damaging 0.92
R0747:Kcnc4 UTSW 3 107448154 missense probably damaging 1.00
R1481:Kcnc4 UTSW 3 107448218 missense probably benign 0.02
R1540:Kcnc4 UTSW 3 107445427 splice site probably null
R1602:Kcnc4 UTSW 3 107448204 missense possibly damaging 0.96
R2422:Kcnc4 UTSW 3 107445547 missense probably benign 0.30
R3750:Kcnc4 UTSW 3 107448190 missense probably benign 0.36
R4791:Kcnc4 UTSW 3 107447543 missense probably benign 0.32
R4815:Kcnc4 UTSW 3 107458266 missense probably benign 0.37
R5216:Kcnc4 UTSW 3 107439441 missense probably benign
R5259:Kcnc4 UTSW 3 107448085 missense probably damaging 1.00
R5317:Kcnc4 UTSW 3 107458739 missense probably damaging 0.98
R5783:Kcnc4 UTSW 3 107447872 missense possibly damaging 0.69
R5865:Kcnc4 UTSW 3 107458199 critical splice donor site probably null
R6228:Kcnc4 UTSW 3 107448377 missense probably damaging 0.99
R6536:Kcnc4 UTSW 3 107448196 missense possibly damaging 0.81
R7018:Kcnc4 UTSW 3 107458862 missense probably benign 0.00
R7319:Kcnc4 UTSW 3 107458784 missense probably benign 0.21
R7687:Kcnc4 UTSW 3 107458609 small insertion probably benign
X0020:Kcnc4 UTSW 3 107447651 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGGCAATGGTCAGCACAC -3'
(R):5'- TGGTTTGTCTTCCAAGGCAG -3'

Sequencing Primer
(F):5'- TGGTCAGCACACCAGCCAG -3'
(R):5'- TCTTCCAAGGCAGCTCGC -3'
Posted On2016-10-06