Incidental Mutation 'R5474:Vav3'
ID433964
Institutional Source Beutler Lab
Gene Symbol Vav3
Ensembl Gene ENSMUSG00000033721
Gene Namevav 3 oncogene
SynonymsIdd18.1, A530094I06Rik
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5474 (G1)
Quality Score220
Status Not validated
Chromosome3
Chromosomal Location109340653-109685698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109664421 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 220 (T220A)
Ref Sequence ENSEMBL: ENSMUSP00000102186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046864] [ENSMUST00000106576]
Predicted Effect probably benign
Transcript: ENSMUST00000046864
AA Change: T780A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036270
Gene: ENSMUSG00000033721
AA Change: T780A

DomainStartEndE-ValueType
CH 3 115 2.1e-18 SMART
low complexity region 160 175 N/A INTRINSIC
RhoGEF 196 370 5.09e-56 SMART
PH 401 504 1.88e-9 SMART
C1 514 562 2.17e-11 SMART
SH3 595 659 6.4e-6 SMART
SH2 670 752 2.59e-26 SMART
SH3 791 847 8.96e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106576
AA Change: T220A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102186
Gene: ENSMUSG00000033721
AA Change: T220A

DomainStartEndE-ValueType
SH3 35 99 3.8e-8 SMART
SH2 110 192 1.6e-28 SMART
SH3 233 289 5.5e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148866
SMART Domains Protein: ENSMUSP00000121660
Gene: ENSMUSG00000033721

DomainStartEndE-ValueType
SH2 33 115 2.59e-26 SMART
PDB:2KBT|A 149 179 6e-6 PDB
Blast:SH3 154 179 2e-10 BLAST
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in tachycardia, systemic arterial hypertension, cardiovascular remodeling, hyperactivity of sympathetic neurons and thus high catecholamine levels, and increased levels of kidney-related hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Vav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Vav3 APN 3 109528392 splice site probably benign
IGL01488:Vav3 APN 3 109657944 missense probably damaging 0.99
IGL01649:Vav3 APN 3 109562762 missense probably benign
IGL01675:Vav3 APN 3 109664413 missense probably benign 0.16
IGL02189:Vav3 APN 3 109525960 splice site probably benign
IGL03134:Vav3 APN 3 109563094 splice site probably benign
IGL03358:Vav3 APN 3 109647673 missense probably damaging 1.00
PIT4131001:Vav3 UTSW 3 109664435 critical splice donor site probably null
R0511:Vav3 UTSW 3 109664440 splice site probably benign
R0542:Vav3 UTSW 3 109527430 missense probably damaging 1.00
R0630:Vav3 UTSW 3 109424012 missense probably damaging 1.00
R0683:Vav3 UTSW 3 109651813 missense probably benign 0.04
R0833:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0836:Vav3 UTSW 3 109647679 missense possibly damaging 0.93
R0940:Vav3 UTSW 3 109562835 missense possibly damaging 0.78
R1561:Vav3 UTSW 3 109494838 critical splice donor site probably null
R1617:Vav3 UTSW 3 109510978 missense probably damaging 1.00
R1760:Vav3 UTSW 3 109341127 missense possibly damaging 0.61
R1834:Vav3 UTSW 3 109506426 missense probably benign 0.06
R1928:Vav3 UTSW 3 109506422 missense possibly damaging 0.94
R2090:Vav3 UTSW 3 109647739 critical splice donor site probably null
R2190:Vav3 UTSW 3 109562814 missense probably damaging 1.00
R2483:Vav3 UTSW 3 109341166 missense probably damaging 1.00
R3124:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3125:Vav3 UTSW 3 109628168 critical splice donor site probably null
R3800:Vav3 UTSW 3 109628039 missense probably benign 0.45
R3919:Vav3 UTSW 3 109527538 missense possibly damaging 0.51
R4693:Vav3 UTSW 3 109563218 splice site probably benign
R4779:Vav3 UTSW 3 109508794 missense possibly damaging 0.88
R5384:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5385:Vav3 UTSW 3 109527475 missense possibly damaging 0.92
R5703:Vav3 UTSW 3 109341241 missense probably benign 0.13
R5997:Vav3 UTSW 3 109501461 missense probably damaging 1.00
R6109:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6110:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6120:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6123:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6124:Vav3 UTSW 3 109664365 missense probably damaging 1.00
R6186:Vav3 UTSW 3 109516067 missense probably damaging 1.00
R6291:Vav3 UTSW 3 109508854 missense possibly damaging 0.82
R6335:Vav3 UTSW 3 109563196 missense probably benign 0.01
R6647:Vav3 UTSW 3 109527416 missense probably benign 0.19
R6849:Vav3 UTSW 3 109521466 missense probably damaging 1.00
R6897:Vav3 UTSW 3 109527494 missense probably damaging 1.00
R7075:Vav3 UTSW 3 109525924 missense possibly damaging 0.47
R7131:Vav3 UTSW 3 109664346 missense probably damaging 1.00
R7328:Vav3 UTSW 3 109503428 missense probably benign 0.10
R7365:Vav3 UTSW 3 109628099 missense possibly damaging 0.67
R7991:Vav3 UTSW 3 109563162 missense probably damaging 1.00
R8151:Vav3 UTSW 3 109508848 missense probably benign
R8164:Vav3 UTSW 3 109341052 missense probably benign
R8170:Vav3 UTSW 3 109424007 missense probably damaging 1.00
R8527:Vav3 UTSW 3 109503471 missense probably damaging 0.98
R8542:Vav3 UTSW 3 109503471 missense probably damaging 0.98
R8734:Vav3 UTSW 3 109657969 missense probably benign 0.00
R8828:Vav3 UTSW 3 109647735 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAGAGCTCTAACTCACACTTTC -3'
(R):5'- CTGACTCTGCTTAGCTCCAG -3'

Sequencing Primer
(F):5'- TCTGGAAATGTTAGGCTTAAAATGAG -3'
(R):5'- GTGTCTGCTCAATGCATTA -3'
Posted On2016-10-06